What is covalent bonds, Biology

Assignment Help:

What is covalent bonds?

Covalent Bonds :  Covalent bonds form when atoms share electrons in order to become more stable. Instead of gaining electrons or losing electrons entirely, atoms share electrons, and thereby form substances with different physical and chemical properties than the component atoms. In a covalent bond, two atoms share a pair of electrons, so that each has a stable outer shell. In a double covalent bond, two pairs of electrons are shared.

For example, two hydrogen atoms are joined by covalent bonds to one oxygen atom to form water. Each hydrogen atom shares its one electron with the oxygen atom (with 6 electrons in its outer shell), filling the oxygen atom's outer shell part of the time. the oxygen atom thus becomes more stable. Each hydrogen atom, on the other hand, is able to share one of the oxygen atom's six outer shell electrons part of the time, in the process becoming more stable as well.

Covalent bonds are classified as being either polar or nonpolar, based on the distribution of the electrons being shared between the two atoms. A polar covalent bond is characterized by an uneven distribution of the electrons. The atom that is more electronegative has a greater relative attraction for electrons, causing the electrons to spend more time on it's side, or pole, of the molecule. Since the electrons are negatively charged, this produces a negatively charged pole. Conversely, the less electronegative pole of the molecule is more positively charged. This uneven electron distribution results in the molecule having two oppositely charged poles.

The water molecule is a prime example of polar covalent bonding. The electrons from each hydrogen, while shared, are strongly attracted to the oxygen atom. As a result, they spend much more time around the oxygen atom than around the hydrogen atoms. This produces an oxygen pole of the water molecule that is electrically negative, and two electrically positive hydrogen poles.

A non-polar covalent bond is characterized by an even distribution of electrons among the atoms of a molecule. Non-polar covalent bonds are present in molecules that have atoms with equal or nearly equal electronegativity. In a diatomic molecule where both atoms have equal attractions for electrons, neither atom would succeed in pulling away electrons from the other. This results in a molecule where the electrons spend equal amounts of time around the component atoms, and an absence of electrically charged poles. Examples of non-polar covalent bonds are molecules of hydrogen gas (H2), and oxygen gas (O2). Since both atoms are the same, they have equal electronegativities and attractions for electrons.

2366_covalent bonding between two hydrogens.png


Related Discussions:- What is covalent bonds

Determine the diversity of biological evolution, Is crossing over important...

Is crossing over important for the diversity of biological evolution? Sexual reproduction and recombination of linked genes (crossing over) are, with mutations, the main instru

Which are the growth tissues of plants, Which are the growth tissues of pla...

Which are the growth tissues of plants? How do they categorize and where can they be found? The growth tissues of the plants are the meristems. Meristems are the tissues that m

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Non-muscular movement, NON-MUSCULA R MOVEMENT - 1 .      Streaming m...

NON-MUSCULA R MOVEMENT - 1 .      Streaming movement - In amoeba, cyclosis is common. 2 .      Pseudopodial - In leucocyte, macrophages, amoeboid movement take place

Plant physiology, detail notes on seed dormancy and seed germination

detail notes on seed dormancy and seed germination

Classification of living organisms, Classification of Living Organisms ...

Classification of Living Organisms The world of living organisms is extremely diverse. Biologists call these diverse forms 'species'. It is estimated that over fifteen lakh (1

Explain tick-borne encephalitis, Tick-Borne Encephalitis (TBE ) TBE occu...

Tick-Borne Encephalitis (TBE ) TBE occurs in Scandinavia, Western and Central Europe and countries of the former USSR, mainly in rural forested areas. Risk is greatest from Apri

Do moulds grow better where it is warm or cold, Do moulds grow better where...

Do moulds grow better where it is warm or cold? This time put single culture dish in a warm dark place and the other in a cold dark place. Study the dishes after a some days.

Etiologic factor of diabetes, Q. Etiologic factor of diabetes? The prec...

Q. Etiologic factor of diabetes? The precise etiology of diabetes is not known but multiple factors contribute to the disorder. These are reviewed herewith. Type I Diabetes

What is drugs, What is drugs? Intravenous access must be established. A...

What is drugs? Intravenous access must be established. Although administration of drugs through a central vein is ideal in a low cardiac output situation, it is rarely possible

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd