Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is commensalism?
The Commensalism is the ecological interaction in which one individual benefits while the other is neither benefited nor harmed. The Commensalism is a harmonious (positive) ecological interaction, since none of the participants is harmed. An instance of commensalism is the numerous bacteria that live in the skin and in the digestive tube of humans without being pathogenic or beneficial and they are innocuous bacteria living in commensalism with humans.
how does odysseus get the dead to talk to him?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the Rh typing of the mother and of the fetus in the hemolytic disease of the newborn? In a hemolytic disease of the newborn the mother is Rh- and the fetus Rh+. In thes
Explain the Liver Biopsy Assays? These are used to measure the total vitamin A stores, as well us, the response in levels of vitamin A relative to different dosages of the vita
are protozoans primitive to life .
What is Portal and Rental Circulation ? The body has other circulation systems that do not return blood directly to the heart. For instance, the blood that drains from the abdo
Kinds of Matter On basis of its chemical organization, matter id of three categories elements, compounds and mixture An element is composed of obviously, earth similar atoms
Differences between Prokaryotes and Eukaryotes It is obvious that there are a number of differences between them. Prokaryotes, like bacterial cells are generally much smaller,
NEURITE S - The processes of neurons are called neurites. These are of two types: dendrites or dendrons and an axon or axis cylinder or neuraxon. (a) Dendrites (Den
Protection of Plants against Toxic Substances Plants produce several toxic substances themselves and may also encounter the ones produced by other plants or present in the env
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd