What is brown algae, Biology

Assignment Help:

What is Brown Algae ?

Phaeophyta are commonly known as brown algae; precisely because they are - guess what? - brown in color! They are brown because they contain brown colored pigments, such as fucoxanthin, in addition to green chlorophyll to help in photosynthesis.

Brown algae are among some of the most common seaweeds, and are abundant almost everywhere along the temperate coastal areas of the world. Some of the larger brown algae form underwater kelp "forests," which are actually farmed and harvested for products extracted from their cell walls. The kelps that form these forests, such as Macrocystis shown below, grow rapidly and can reach over 100 meters in length. Like any other forest, the kelp forests, along with their accompanying marine invertebrates, fish, birds and marine mammals, make up unique and interesting ecosystems.

 


Related Discussions:- What is brown algae

Role of cell death, Role of cell death As development of the limb proc...

Role of cell death As development of the limb proceeds waves of death or necrosis of large masses of mesodermal cells occur in certain regions at different stages. This has be

Define the role of fluorine in human body, Define the role of Fluorine in H...

Define the role of Fluorine in Human Body? Fluorine is potentially a toxic element. Its essentiality for humans is not established although the role of fluoride in providing pr

Which is the normal sign of the electric charge, Which is the normal sign o...

Which is the normal sign of the electric charge among the two sides of the neuron plasma membrane? What is the potential difference (voltage) generated among these two sides? What

What are the symptoms of mitral stenosis, Q. What are the Symptoms of Mitra...

Q. What are the Symptoms of Mitral stenosis? The cardinal symptom of mitral stenosis is dyspnoea on exertion. Typically it progresses over a period of years. As the severity in

Explain the treatment of susceptible tb, Treatment of susceptible tb Al...

Treatment of susceptible tb All isolates of Mycobacterium tuberculosis should be tested for antimicrobial susceptibility, but results generally do not become available for at l

Management of diabetes, By now you know that diabetes cannot be cured but c...

By now you know that diabetes cannot be cured but can be treated so that an individual leads a normal life. Patients who maintain their blood glucose levels within the normal range

Explain risk factors and their role in cad, Explain risk factors and their ...

Explain risk factors and their role in cad ? The concept of risk factors constitutes a major advance for developing strategies to prevent CVD. The Framingham Heat Study played

Why food which can be taken in plenty, Food Which can be Taken in Plenty an...

Food Which can be Taken in Plenty and Food to be Avoided Lastly, in the context of changing the diet, we should know the foods to be avoided and the food to be taken in plenty

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd