What is biotic potential, Biology

Assignment Help:

Q. What is biotic potential?

The Biotic potential is the capability of growth of a given population under hypothetical optimum conditions, i.e., in an environment without limiting factors to such growth. Under such circumstances the population tends to grow indefinitely.


Related Discussions:- What is biotic potential

Explain protein, What is protein? 1) Protein is a source of backup ener...

What is protein? 1) Protein is a source of backup energy that your body keeps, a large difficult molecule made up of one or more chains of amino acids. Proteins perform a wide

What is the general chemical equation of photosynthesis, What is the genera...

What is the general chemical equation of photosynthesis? Why doesn't that equation clearly show the real origin of the molecular oxygen liberated? The general equation of photo

What would be its final volume, Consider a simple spherical model cell that...

Consider a simple spherical model cell that consists of cytoplasm and a plasma membrane. The cell's initial volume is 2 nL and contains 0.2 M protein. The cell is placed in a la

What do you meant by medical writing, Question 1 : What do you meant by ...

Question 1 : What do you meant by medical writing? Show various types of medical writing. Define and explain briefly medical writing Discuss various types of medical w

What happens to pepsin when it passes into the duodenum, Q. Since pepsin is...

Q. Since pepsin is a gastric enzyme does it have a basic or an acid optimum pH? What happens to pepsin when it passes into the duodenum? Pepsin acts contained by the stomach so

Zoonotic diseases-influenza, Influenza Influenza is an acute infectious di...

Influenza Influenza is an acute infectious disease caused by influenza viruses of genus Orthomyxovirus in family Orthomyxoviridae. The name Influenza is derived from an Italian ph

Embryology, Explain the gradient theoryof experimental embryology

Explain the gradient theoryof experimental embryology

Mandibles, which animal have most developed mandible

which animal have most developed mandible

DNA fingerprinting, This method makes use of a common, but peculiar, group ...

This method makes use of a common, but peculiar, group of DNA sequences known as minisatellites. High levels of variation in the numbers of these repeated units are used in "DNA fi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd