Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is biotic potential?
The Biotic potential is the capability of growth of a given population under hypothetical optimum conditions, i.e., in an environment without limiting factors to such growth. Under such circumstances the population tends to grow indefinitely.
What is protein? 1) Protein is a source of backup energy that your body keeps, a large difficult molecule made up of one or more chains of amino acids. Proteins perform a wide
What is the general chemical equation of photosynthesis? Why doesn't that equation clearly show the real origin of the molecular oxygen liberated? The general equation of photo
Consider a simple spherical model cell that consists of cytoplasm and a plasma membrane. The cell's initial volume is 2 nL and contains 0.2 M protein. The cell is placed in a la
Question 1 : What do you meant by medical writing? Show various types of medical writing. Define and explain briefly medical writing Discuss various types of medical w
Q. Since pepsin is a gastric enzyme does it have a basic or an acid optimum pH? What happens to pepsin when it passes into the duodenum? Pepsin acts contained by the stomach so
Influenza Influenza is an acute infectious disease caused by influenza viruses of genus Orthomyxovirus in family Orthomyxoviridae. The name Influenza is derived from an Italian ph
Explain the gradient theoryof experimental embryology
which animal have most developed mandible
This method makes use of a common, but peculiar, group of DNA sequences known as minisatellites. High levels of variation in the numbers of these repeated units are used in "DNA fi
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd