Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Availability of nutrients in soils
The productivity of a crop depends largely on the nutrients discussed in the previous section. It is important to find out methods which will help in estimating the availability of these nutrients in soil. The fraction of nutrient actually available in the soil for plant utilisation is called as available soil nutrient.
Pantothenic acid (Calcium pantothenate) Calcium pantothenate is a white, loose, faintly hygroscopic powder without odour and of bitter taste. It is easily soluble in water, gly
Problem of Polarity in Regeneration in Planarians As in Hydra, flatworm regeneration as well appears to occur in a polar fashion. There seems to be ananterior-posterior gradie
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
The Environmental Disasters Are Classified Into Two Major Categories: 1. Natural Disasters like Earthquakes, Tsunami, Landslides, Cyclones, Floods, and Droughts Etc. 2.
Noise Exposures - Factors Affecting Occupational Health Various equipment and processes generate noise of varying intensity and - frequency. In this respect ventilation system
Evidence for Existence of Light and Dark Reactions The process of photosynthesis was known in its bare outline already at the beginning of this century. But the phenomenon wa
what is phulum cnideria
Which of the following is true for a G-protein? A. When an agonist binds to the binding site of a G-protein-coupled receptor (GPCR), this leads to GDP displacing a GTP bound to
Mr. Smith read that cholesterol was bad for his health so he eliminated all foods and food products containing this molecule. He later found that his cholesterol level dropped only
The nucleolus is a small and optically dense region in the interior of the cell nucleus. It is made of ribosomic RNA (rRNA) and proteins. Single nucleus can have one or more nucleo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd