What is atomic constipation, Biology

Assignment Help:

Q. What is Atomic constipation?

This type is most common; often it is called the "lazy .bowel". There is a loss of muscle tone causing weak peristalsis, the causes are:

a) Lack of fluids, rouhage and potassium

b) Vitamin B Complex deficiency

c) Irregular defecation habit and poor personal hygiene.

d) Excessive purgation or use of enema.

e) Sedentary lifestyle or lack of exercise


Related Discussions:- What is atomic constipation

Diseases, what are the sources of infection (human, animal and non-living r...

what are the sources of infection (human, animal and non-living reservoirs), the routes of transmission (way in which the infection spreads) and different ways in which micro-organ

Difference between medullated and non-medullated fibres, DIFFERENCE S BETW...

DIFFERENCE S BETWEEN MEDULLATED AND NON-MEDULLATED NERVE FIBRES       1. Medullated (Myelinated) Nerve Fibres Medullary sheath is present.

Protozoa., brief account on classification and general characters of protoz...

brief account on classification and general characters of protozoa

Illustrate goal of modern dentistry, Q. Illustrate goal of modern dentistry...

Q. Illustrate goal of modern dentistry? The goal of modern dentistry is to restore the patient to normal contour, comfort, function, esthetics, speech and health regardless of

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain functions of ascorbic acid, Explain Functions of Ascorbic Acid? ...

Explain Functions of Ascorbic Acid? Vitamin C is easily oxidized, and the majority of its functions in vivo rely on this property. It plays a key role in the body's synthesis o

Non-succulent perennials, Non-succulent perennials These are actually t...

Non-succulent perennials These are actually the true xerophytes or drought resistants, because they possess a number of morphological, anatomical and physiological characterist

Describe the experimental approach using the tools, For many of the mammali...

For many of the mammalian Hox genes, it has been possible to determine that some of them are more similar to one of the insect HOM-C genes than to the others. Describe an experimen

Endocine organ, #question.endocrine organ in crustaceans

#question.endocrine organ in crustaceans

Industrial processes that use bacteria, Q. What are few industrial processe...

Q. What are few industrial processes that use bacteria? Bacteria are used by industry in different ways. There are vaccines made of antigens present in bacteria or of attenuate

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd