Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is Atomic constipation?
This type is most common; often it is called the "lazy .bowel". There is a loss of muscle tone causing weak peristalsis, the causes are:
a) Lack of fluids, rouhage and potassium
b) Vitamin B Complex deficiency
c) Irregular defecation habit and poor personal hygiene.
d) Excessive purgation or use of enema.
e) Sedentary lifestyle or lack of exercise
what are the sources of infection (human, animal and non-living reservoirs), the routes of transmission (way in which the infection spreads) and different ways in which micro-organ
DIFFERENCE S BETWEEN MEDULLATED AND NON-MEDULLATED NERVE FIBRES 1. Medullated (Myelinated) Nerve Fibres Medullary sheath is present.
brief account on classification and general characters of protozoa
Q. Illustrate goal of modern dentistry? The goal of modern dentistry is to restore the patient to normal contour, comfort, function, esthetics, speech and health regardless of
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Functions of Ascorbic Acid? Vitamin C is easily oxidized, and the majority of its functions in vivo rely on this property. It plays a key role in the body's synthesis o
Non-succulent perennials These are actually the true xerophytes or drought resistants, because they possess a number of morphological, anatomical and physiological characterist
For many of the mammalian Hox genes, it has been possible to determine that some of them are more similar to one of the insect HOM-C genes than to the others. Describe an experimen
#question.endocrine organ in crustaceans
Q. What are few industrial processes that use bacteria? Bacteria are used by industry in different ways. There are vaccines made of antigens present in bacteria or of attenuate
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd