Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is a goiter? What is endemic goiter? How is this problem socially solved?
Goiter is the abnormal enlargement of the thyroid gland. The goiter appears as a tumor in the anterior neck and it might be visible or sometimes not visible but palpable. Goiter can happen in hypothyroidism or in hyperthyroidism.
Endemic goiter is the goiter caused by deficient iodine ingestion (deficiency of iodine in the diet). The endemic character of the disease is defined because the iodine content of the diet is often a social or cultural condition affecting many people of some geographical regions. The hypothyroidism caused by deficient iodine ingestion is more frequent in regions far from the sea coast (as sea food is rich in iodine).
1. Using specific examples describe how variations in DNA sequence between individuals can lead to risk of disease. Describe how a range of techniques have been adapted to detect s
discuss about protozoa,metazoa,mesozoa and parazoa
What is pcr?
how many chromosomes in human
Define some Precautions for spore staining in a given bacterial culture? 1. Do not allow malachite green to dry on slide. 2. Decolourization should be done only after coolin
What is Conventional breeding Conventional breeding is a process in which genes for pesticidal traits are introduced into a plant by natural methods, such as cross-pollination
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what carbohydrates does a plant make from glucose
What is the excreatory organ in agama lizard
Q. Why is waste considered one of the major environmental issues? The environmental problem regarding waste worsens with industrial development and the global growth of consump
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd