What is a goiter, Biology

Assignment Help:

What is a goiter? What is endemic goiter? How is this problem socially solved?

Goiter is the abnormal enlargement of the thyroid gland. The goiter appears as a tumor in the anterior neck and it might be visible or sometimes not visible but palpable. Goiter can happen in hypothyroidism or in hyperthyroidism.

Endemic goiter is the goiter caused by deficient iodine ingestion (deficiency of iodine in the diet). The endemic character of the disease is defined because the iodine content of the diet is often a social or cultural condition affecting many people of some geographical regions. The hypothyroidism caused by deficient iodine ingestion is more frequent in regions far from the sea coast (as sea food is rich in iodine).

 


Related Discussions:- What is a goiter

Gametophytic incompatibility, Gametophytic Incompatibility In GSI syst...

Gametophytic Incompatibility In GSI systems callose deposition is not evident on the stigma but is very conspicuous in the pollen tube. Sometimes the callose deposition occurs

Nursing care plan, Mrs. TT seventy three-year old has a long history of chr...

Mrs. TT seventy three-year old has a long history of chronic obstructive pulmonary disease (COPD). She came to the medical ward as shortness of breath, wheezing and a cough for the

Cat assay, CAT assay  is an enzyme assay. CAT stands for the chloramphenico...

CAT assay  is an enzyme assay. CAT stands for the chloramphenicol acetyl transferase, a bacterial enzyme which inactivates the chloramphenicol by acetylating it. CAT assays are man

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Discuss the evolution of implants in dentistry, Q. Discuss the evolution of...

Q. Discuss the evolution of implants in dentistry? The first use of Implants dates back to 600 A.D. in the Mayan population where intraosseous implantation of animal teeth or t

What are the major parts of ferns, Q. What are the major parts of ferns? ...

Q. What are the major parts of ferns? Ferns are constituted by small roots that come downwards from the rhizome stem and often horizontalized. The fronds also arise from the rh

What is embryonic origin of the nervous system in vertebrate, How does the ...

How does the embryo turn from gastrula into neurula? How is the neural tube formed? What is the embryonic origin of the nervous system in vertebrates? The neurula stage is divi

Composition-atmosphere, Composition The present day composition of atmo...

Composition The present day composition of atmosphere is the product of a lengthy evolutionary process that began more than four billion years ago. It is composed of a mixture

When should eat a salad with lettuce, When you eat a salad with lettuce, cr...

When you eat a salad with lettuce, croutons, hard-boiled egg, bacon bits, and salad dressing, which one of those ingredients will be broken down the least by your digestive system?

Marchantia , why vegetative reproduction use in marchantia

why vegetative reproduction use in marchantia

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd