Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is a goiter? What is endemic goiter? How is this problem socially solved?
Goiter is the abnormal enlargement of the thyroid gland. The goiter appears as a tumor in the anterior neck and it might be visible or sometimes not visible but palpable. Goiter can happen in hypothyroidism or in hyperthyroidism.
Endemic goiter is the goiter caused by deficient iodine ingestion (deficiency of iodine in the diet). The endemic character of the disease is defined because the iodine content of the diet is often a social or cultural condition affecting many people of some geographical regions. The hypothyroidism caused by deficient iodine ingestion is more frequent in regions far from the sea coast (as sea food is rich in iodine).
Gametophytic Incompatibility In GSI systems callose deposition is not evident on the stigma but is very conspicuous in the pollen tube. Sometimes the callose deposition occurs
Mrs. TT seventy three-year old has a long history of chronic obstructive pulmonary disease (COPD). She came to the medical ward as shortness of breath, wheezing and a cough for the
CAT assay is an enzyme assay. CAT stands for the chloramphenicol acetyl transferase, a bacterial enzyme which inactivates the chloramphenicol by acetylating it. CAT assays are man
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Discuss the evolution of implants in dentistry? The first use of Implants dates back to 600 A.D. in the Mayan population where intraosseous implantation of animal teeth or t
Q. What are the major parts of ferns? Ferns are constituted by small roots that come downwards from the rhizome stem and often horizontalized. The fronds also arise from the rh
How does the embryo turn from gastrula into neurula? How is the neural tube formed? What is the embryonic origin of the nervous system in vertebrates? The neurula stage is divi
Composition The present day composition of atmosphere is the product of a lengthy evolutionary process that began more than four billion years ago. It is composed of a mixture
When you eat a salad with lettuce, croutons, hard-boiled egg, bacon bits, and salad dressing, which one of those ingredients will be broken down the least by your digestive system?
why vegetative reproduction use in marchantia
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd