What is a goiter, Biology

Assignment Help:

What is a goiter? What is endemic goiter? How is this problem socially solved?

Goiter is the abnormal enlargement of the thyroid gland. The goiter appears as a tumor in the anterior neck and it might be visible or sometimes not visible but palpable. Goiter can happen in hypothyroidism or in hyperthyroidism.

Endemic goiter is the goiter caused by deficient iodine ingestion (deficiency of iodine in the diet). The endemic character of the disease is defined because the iodine content of the diet is often a social or cultural condition affecting many people of some geographical regions. The hypothyroidism caused by deficient iodine ingestion is more frequent in regions far from the sea coast (as sea food is rich in iodine).

 


Related Discussions:- What is a goiter

Describe how the various molecular mechanisms act, 1. Using specific exampl...

1. Using specific examples describe how variations in DNA sequence between individuals can lead to risk of disease. Describe how a range of techniques have been adapted to detect s

Classification, discuss about protozoa,metazoa,mesozoa and parazoa

discuss about protozoa,metazoa,mesozoa and parazoa

Pcr, What is pcr?

What is pcr?

Rk, how many chromosomes in human

how many chromosomes in human

Precautions for spore staining in a given bacterial culture, Define some Pr...

Define some Precautions for spore staining in a given bacterial culture? 1. Do not allow malachite green to dry on slide. 2. Decolourization should be done only after coolin

What is conventional breeding, What is Conventional breeding Conventio...

What is Conventional breeding Conventional breeding is a process in which genes for pesticidal traits are introduced into a plant by natural methods, such as cross-pollination

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Photosynthesis., what carbohydrates does a plant make from glucose

what carbohydrates does a plant make from glucose

Excreation, What is the excreatory organ in agama lizard

What is the excreatory organ in agama lizard

Why waste considered major environmental issues, Q. Why is waste considered...

Q. Why is waste considered one of the major environmental issues? The environmental problem regarding waste worsens with industrial development and the global growth of consump

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd