What is a food chain?, Biology

Assignment Help:

What is a food chain?

The food chain is not branched it is linear sequence in which a living being serves as food for another, starting with the producers and going up to the decomposers

 


Related Discussions:- What is a food chain?

Explain about hyperglycemia, Q. Explain about Hyperglycemia? It is a Gr...

Q. Explain about Hyperglycemia? It is a Greek term: hyper -meaning excessive; glyc- meaning sweet; and emia- means "of the blood". It is a condition in which an excessive amoun

Body cavity and coelom - metazoa, Body Cavity and Coelom - Metazoa Vac...

Body Cavity and Coelom - Metazoa Vacuoles, spaces, lacunae and cavities have been of importance in all organisms, may it a be plant or animal. All animals have cavities. The c

Pisciculture, Pisciculture: This is the culturing of fishes. There is a pri...

Pisciculture: This is the culturing of fishes. There is a principal form of aquaculture called Fish farming, while other methods can come under mariculture. Fish farming main aim i

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Messenger rna (mrna), Messenger RNA (mRNA) are the proteins are not synthe...

Messenger RNA (mRNA) are the proteins are not synthesized directly from the genomic DNA. Insteadof that an RNA template (a precursor mRNA) is constructed from the sequence of gene

Blood, what are the component of hemoglobin

what are the component of hemoglobin

Vasa recta - vertebrate kidney, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Management of pulmonary edema, Pulmonary edema is life-threatening conditio...

Pulmonary edema is life-threatening condition and therefore, treated as a medical emergency. As is the case with chronic stable heart failure, identification and correction of any

Illustrate about the neuropsychological battery, NEUROPSYCHOLOGICAL BATTERY...

NEUROPSYCHOLOGICAL BATTERY The battery was published in 1980 by Western Psychological Services and is now extensively used in clinical and research applications. An alternate

Define the importance of iodine in human, Define the importance of Iodine i...

Define the importance of Iodine in human? Iodine derives the nutritional importance as a constituent of thyroid hormones, 3,5,3',5' tetraiodo-thyronine (thyroxine or T 4 ) and

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd