Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is a food chain?
The food chain is not branched it is linear sequence in which a living being serves as food for another, starting with the producers and going up to the decomposers
Q. Explain about Hyperglycemia? It is a Greek term: hyper -meaning excessive; glyc- meaning sweet; and emia- means "of the blood". It is a condition in which an excessive amoun
Body Cavity and Coelom - Metazoa Vacuoles, spaces, lacunae and cavities have been of importance in all organisms, may it a be plant or animal. All animals have cavities. The c
Pisciculture: This is the culturing of fishes. There is a principal form of aquaculture called Fish farming, while other methods can come under mariculture. Fish farming main aim i
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Messenger RNA (mRNA) are the proteins are not synthesized directly from the genomic DNA. Insteadof that an RNA template (a precursor mRNA) is constructed from the sequence of gene
what are the component of hemoglobin
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Pulmonary edema is life-threatening condition and therefore, treated as a medical emergency. As is the case with chronic stable heart failure, identification and correction of any
NEUROPSYCHOLOGICAL BATTERY The battery was published in 1980 by Western Psychological Services and is now extensively used in clinical and research applications. An alternate
Define the importance of Iodine in human? Iodine derives the nutritional importance as a constituent of thyroid hormones, 3,5,3',5' tetraiodo-thyronine (thyroxine or T 4 ) and
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd