What is a cytoskeleton, Biology

Assignment Help:

What is a cytoskeleton? What are its main constituents in animal cells?

Cytoskeleton is the cytoplasmic structure that handles the cell, keeps its shape and fixates and moves the cell organelles. It is made of an extensive network of fibers dispersed in the cytoplasm and anchored in the plasma membrane. Its mechanisms are microtubules, microfilaments and intermediate filaments.

Cell Skeleton and Cell Movement - Image Diversity: the "cell skeleton"

 


Related Discussions:- What is a cytoskeleton

Asexual reproduction in fungi, Asexual reproduction in fungi Fungi repr...

Asexual reproduction in fungi Fungi reproduce asexually by means of sporulation and fragmentation. Fragmentation : This is a type of asexual reproduction in fungi whi

Determine the biological diversity of an ecosystem, Is monoculture a system...

Is monoculture a system that contributes to great biological diversity of an ecosystem? Monoculture means that in a large area a single crop (only single species of plant) is c

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Epithelial Cells, What are all teh parts of a simple ciliated columnar epit...

What are all teh parts of a simple ciliated columnar epithilial cell?

Phobias, PHOBIA S - Common phobias for - Spiders Lizards Snak...

PHOBIA S - Common phobias for - Spiders Lizards Snakes Cockroach Crowded places Vast open places Closed small chambers.

., what is the skeleton in the different classes of coelentrata known

what is the skeleton in the different classes of coelentrata known

Peculiarities of mitosis - cleavage, Peculiarities of Mitosis - Cleavage ...

Peculiarities of Mitosis - Cleavage From the following you will learn that the mitosis in the phase of cleavage has some striking peculiarities: a) Synchronization of cell

Coronary revascularization, When underlying coronary artery disease is the ...

When underlying coronary artery disease is the cause of heart failure in the coronary revascularization may both improve symptoms and prevent  progression. Patients with angina and

The reproductive system of house fly, The reproductive system of house fly:...

The reproductive system of house fly: In houseflies seperate male and female organisms are present. Male housefly reproductive system. The male hothe reproductive syste

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd