What happens to denatured enzyme regarding it functionality, Biology

Assignment Help:

What happens to a denatured enzyme regarding its functionality? How can that result be explained with the help of the lock and key model?

According to the lock and key model the enzyme functionality depends totally on the integrity of the activation center, a molecular region with exact spatial characteristics. After the denaturation the spatial conformation of the protein is modified, the start center is destroyed and the enzyme loses its catalytic activity.

 


Related Discussions:- What happens to denatured enzyme regarding it functionality

What is adp phosphorylation, What is ADP phosphorylation? What respectively...

What is ADP phosphorylation? What respectively are photophosphorylation and oxidative phosphorylation? ADP phosphorylation is the addition of one inorganic phosphate in the mol

The ideas of energy and chemical cycles, How do the ideas of energy and che...

How do the ideas of energy and chemical cycles, community structure, biodiversity and succession fit together to form the basis of the way the natural world works?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the use of spectinomycin in pregnancy, Use of Spectinomycin in Preg...

Use of Spectinomycin in Pregnancy  Spectinomycin (Trobicin) can be used to treat pregnant women allergic to beta-lactam antibiotics, but is unreliable against pharyngeal gonoco

Active listening - counselling skills used in diabetes, Q. Active Listening...

Q. Active Listening - counselling skills used in diabetes? Every day we listen to many things, may be not with any intention or paying attention to the words, speech etc. For i

Why does geographical isolation lead to speciation?, Why does geographical ...

Why does geographical isolation lead to speciation? The Geographical isolation between groups of the same species leads to formation of a new species since it disallows crossin

Explain major role in contributing towards motivation, Major role in contri...

Major role in contributing towards motivation. Psychological factors: Depression, anxiety or phobia induced by illness,  life- style changes or medication effects, may hinder

Explain diffrent type of mycotoxins, Q. Explain diffrent type of Mycotoxins...

Q. Explain diffrent type of Mycotoxins? Mycotoxins are secondary metabolites produced by molds on foodstuffs that cause illness or death when ingested by man or animals. The pr

Excretory , What are excretory organ and product of a lizard

What are excretory organ and product of a lizard

The eye refract the light, Which parts of the eye refract ('bend') the ligh...

Which parts of the eye refract ('bend') the light in such a way as to form an image on the retina?   The curved surface of the cornea, and the aqueous humour enclosed by it,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd