Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What happens to a denatured enzyme regarding its functionality? How can that result be explained with the help of the lock and key model?
According to the lock and key model the enzyme functionality depends totally on the integrity of the activation center, a molecular region with exact spatial characteristics. After the denaturation the spatial conformation of the protein is modified, the start center is destroyed and the enzyme loses its catalytic activity.
What is ADP phosphorylation? What respectively are photophosphorylation and oxidative phosphorylation? ADP phosphorylation is the addition of one inorganic phosphate in the mol
How do the ideas of energy and chemical cycles, community structure, biodiversity and succession fit together to form the basis of the way the natural world works?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Use of Spectinomycin in Pregnancy Spectinomycin (Trobicin) can be used to treat pregnant women allergic to beta-lactam antibiotics, but is unreliable against pharyngeal gonoco
Q. Active Listening - counselling skills used in diabetes? Every day we listen to many things, may be not with any intention or paying attention to the words, speech etc. For i
Why does geographical isolation lead to speciation? The Geographical isolation between groups of the same species leads to formation of a new species since it disallows crossin
Major role in contributing towards motivation. Psychological factors: Depression, anxiety or phobia induced by illness, life- style changes or medication effects, may hinder
Q. Explain diffrent type of Mycotoxins? Mycotoxins are secondary metabolites produced by molds on foodstuffs that cause illness or death when ingested by man or animals. The pr
What are excretory organ and product of a lizard
Which parts of the eye refract ('bend') the light in such a way as to form an image on the retina? The curved surface of the cornea, and the aqueous humour enclosed by it,
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd