What food items include in full liquid diet, Biology

Assignment Help:

What food items  include in full liquid diet

-  Soups and broths

-  Cereal porridges (refined cereals)

-  Milk and milk beverages, yoghurt

- Coffee, tea, fruit  juices, carbonated beverages

-  Butter, cream and oil added to foods

-  Plain puddings, custard, ice-cream, jelly, and

-  Sugar, honey, salt and mild flavourings,

 


Related Discussions:- What food items include in full liquid diet

What hormone can be used to overcome jet lag?, Q. What hormone can be used ...

Q. What hormone can be used to overcome jet lag? Jet lag takes place when an individual's biological clock is out of sync with local time. According to general rule it takes ab

Control of glycogen metabolism, The major factor which controls glycogen me...

The major factor which controls glycogen metabolism in the liver is the concentration of phorphorylase alpha. Certainly, this enzyme catalyzes the limiting step of glycogen breakdo

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you mean by proteinuria, Q. What is proteinuria? Why is proteinuria...

Q. What is proteinuria? Why is proteinuria a sign of glomerular renal injury? Proteinuria means losing of proteins through urine under normal conditions proteins are too big to

Algae, The difference b/n algae,bryophyte&pteridophyte?

The difference b/n algae,bryophyte&pteridophyte?

What is allantois, What is Allantois One of the extraembryonic eggs foun...

What is Allantois One of the extraembryonic eggs found in the amniote animals. The allantois contains the metabolic wastes created by the developing embryo. May also be involved

Determine the benefits of exercises, Benefits of Exercises Benefits of ...

Benefits of Exercises Benefits of exercises for a diabetic patient are given below: - Improves sugar control. - Decreases HbA1C level. - Decreases blood pressure. -

Relation between the hypophysis and the thyroid, Q. What is the relation be...

Q. What is the relation between the hypophysis and the thyroid? The hypophysis secretes TSH (thyroid- stimulating hormone). This hormone hastens the secretion of thyroid hormon

Determine the general principles for incisions, General Principles for Inci...

General Principles for Incisions The general principles for placing incisions so as to create surgical flaps remain the same regardless of the reason for creating them. These a

How dna helps growing human population, How recombinant DNA Technology can ...

How recombinant DNA Technology can help sustain growing human population?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd