Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What food items include in full liquid diet
- Soups and broths
- Cereal porridges (refined cereals)
- Milk and milk beverages, yoghurt
- Coffee, tea, fruit juices, carbonated beverages
- Butter, cream and oil added to foods
- Plain puddings, custard, ice-cream, jelly, and
- Sugar, honey, salt and mild flavourings,
Q. What hormone can be used to overcome jet lag? Jet lag takes place when an individual's biological clock is out of sync with local time. According to general rule it takes ab
The major factor which controls glycogen metabolism in the liver is the concentration of phorphorylase alpha. Certainly, this enzyme catalyzes the limiting step of glycogen breakdo
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is proteinuria? Why is proteinuria a sign of glomerular renal injury? Proteinuria means losing of proteins through urine under normal conditions proteins are too big to
The difference b/n algae,bryophyte&pteridophyte?
What is Allantois One of the extraembryonic eggs found in the amniote animals. The allantois contains the metabolic wastes created by the developing embryo. May also be involved
Benefits of Exercises Benefits of exercises for a diabetic patient are given below: - Improves sugar control. - Decreases HbA1C level. - Decreases blood pressure. -
Q. What is the relation between the hypophysis and the thyroid? The hypophysis secretes TSH (thyroid- stimulating hormone). This hormone hastens the secretion of thyroid hormon
General Principles for Incisions The general principles for placing incisions so as to create surgical flaps remain the same regardless of the reason for creating them. These a
How recombinant DNA Technology can help sustain growing human population?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd