Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What do you understand by Polyp?
The sessile, asexual stage in the cnidarian life cycle. In some species they are independent organisms; in others, they form colonies where some polyps are involved in food gathering (gastrozooids) and other polyps produce reproductive stage (gonozooids).
Does natural selection produce an effect directly on genes, on genotypes, or on phenotypes? Explain please.
EMERGENC E OF CONTEMPORARY BIOLOGY - 1 . Aristotle (384-322BC) - Greek Classified animal species and arranged them in hierarchies. Formulated 'Great chain of
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Describe Components of a Complete Diagnosis of Congenital Heart Disease ? A complete diagnosis of congenital heart disease requires accurate and thorough description of the he
Define Counter Stain - Staining Technique? Finally, the smear is counter stained with a simple basic dye different in colour from crystal violet. Safranin is the most commonly
Provide a link to the graph, describe the variables, and interpret the meaning of the graph
Q. To what substance is the acidic flavor of fermented milk due? Some bacteria ferment milk lactose by lactic fermentation producing lactic acid this product is responsible for
KIDNEY S - Origin . They develop from the mesoderm of the embryo. The kidneys secrete three hormones: renin, erythropoetin and calcitriol. (i) Renin . Whenever the rat
Q. What are the lichens? How fungi participate in this ecological interaction? Lichens are formed by mutualist ecological interaction between algae and fungi or between fungi a
Ablation experiment is an experiment designed to produce an animal deficient in one or the few cell types, in order to study cell lineage or the cell function. The logic is to mak
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd