What do you understand by polyp?, Biology

Assignment Help:

What do you understand by Polyp?

The sessile, asexual stage in the cnidarian life cycle. In some species they are independent organisms; in others, they form colonies where some polyps are involved in food gathering (gastrozooids) and other polyps produce reproductive stage (gonozooids).


Related Discussions:- What do you understand by polyp?

Anaemia, A n a e m i a It is defined as decrease in the amount of...

A n a e m i a It is defined as decrease in the amount of haemoglobin (Hb) per unit of blood. This may or may not be accompanied by a reduction in the red blood cells (RBC

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Disaster management cycle and it''s components, Disaster management is aime...

Disaster management is aimed at minimizing or avoiding the potential losses from extreme events and assuring rapid and proper help to the affected people and ascertaining a quick a

Expression clone, Expression clone  is a clone (plasmid in the bacteria, or...

Expression clone  is a clone (plasmid in the bacteria, or might be a lambda phage in bacteria) which is designed to produce the protein from the DNA insert. Mammalian genes do not

Illustrate meiotic division, Q. In which meiotic division does the separati...

Q. In which meiotic division does the separation of the homologous take place and what are the ploidies of the generated cells after the end of that process? The separation of

What is the chemical content of those organelles, Q. On which organelle of ...

Q. On which organelle of the cell structure does intracellular digestion depend? What is the chemical content of those organelles? Intracellular digestion take place by the act

Determine the following term - amniote egg, Determine the following term - ...

Determine the following term - Amniote egg Eggs that shelter the developing embryo in a water-filled sac—the amnion. Characteristic of the amniote animals, which include reptil

Infectious and chronic diseases, Infectious and Chronic Diseases The m...

Infectious and Chronic Diseases The most prevalent diseases of poverty, many of which are also infectious by nature, are malaria, tuberculosis, respiratory infections, water b

Role of citric acid cycle, The citric acid cycle, also called as the tricar...

The citric acid cycle, also called as the tricarboxylic acid (TCA) cycle or Krebs cycle (after its discoverer in the year of 1937), is used to oxidize the pyruvate making during th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd