Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What do you understand by Polyp?
The sessile, asexual stage in the cnidarian life cycle. In some species they are independent organisms; in others, they form colonies where some polyps are involved in food gathering (gastrozooids) and other polyps produce reproductive stage (gonozooids).
A n a e m i a It is defined as decrease in the amount of haemoglobin (Hb) per unit of blood. This may or may not be accompanied by a reduction in the red blood cells (RBC
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
cellular respiration
Disaster management is aimed at minimizing or avoiding the potential losses from extreme events and assuring rapid and proper help to the affected people and ascertaining a quick a
Expression clone is a clone (plasmid in the bacteria, or might be a lambda phage in bacteria) which is designed to produce the protein from the DNA insert. Mammalian genes do not
Q. In which meiotic division does the separation of the homologous take place and what are the ploidies of the generated cells after the end of that process? The separation of
Q. On which organelle of the cell structure does intracellular digestion depend? What is the chemical content of those organelles? Intracellular digestion take place by the act
Determine the following term - Amniote egg Eggs that shelter the developing embryo in a water-filled sac—the amnion. Characteristic of the amniote animals, which include reptil
Infectious and Chronic Diseases The most prevalent diseases of poverty, many of which are also infectious by nature, are malaria, tuberculosis, respiratory infections, water b
The citric acid cycle, also called as the tricarboxylic acid (TCA) cycle or Krebs cycle (after its discoverer in the year of 1937), is used to oxidize the pyruvate making during th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd