Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What do you mean by Insect control?
The insects can breed and hide in garbage and other places where there is availability of waste materials. The cockroach lives and breed in moist dark places around plumbing cupboard, pantries and under refrigerators. The best prevention approach is to fit all the doors, windows and ventilation with wire-mesh. The flying insects can be destroyed by employing fluorescent tubes which attract and destroy them due to an electrified field. They are collected in a collecting tray. The crawling insect hideout should be sealed by blocking all the cracks etc. which harbor insects. They are generally destroyed by spraying and using commercial insecticides like pyrethrum. The cockroaches can be prevented entry by painting a band of insecticide between the joints of wall and floor. Of late, aerosol sprays have become very popular in eliminating flying insects. But care has to be taken to avoid contamination of foods and food contact surfaces getting sprayed with the aerosols.
What is the disease caused by dietary iodine deficiency? Iodine deficiency causes hypothyroidism, an abnormally lower production of thyroid hormones that require iodine to be s
What are the types of brain?
Cutaneous respiration in frogs and toads
What is Cloning Cloning: Somatic (ie 2N) cell from original female cat removed (nucleus has mutated allele), fertilised egg extracted from another cat, nucleus removed, and egg
Explain the Scanning Electron Microscope It can be used to observe intact cells or cell components directly. Then sections are not necessary. It is used for visualizing surface
The ideal clinical conditions of teeth which we know already include: - the absence of pain. - less than 0.1 mm initial hori-ontal mobility under lateral forces of less than
Define Vitamins B 12 Deficiency in Vegans? Because plants do not synthesize vitamin B 12 , individuals who consume diets completely free of animal products (vegan diets) are a
Why in the preparation of a karyotype analysis is the use of a substance like colchicine interesting? The Colchicine is a substance that disallows the formation of microtubules
What is the meaning of Cardiovascular System ? The cardiovascular system takes care of the distribution of gases, nutrients, hormones, immune elements, and the removal of waste
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd