What do protozoans eat, Biology

Assignment Help:

What do protozoans "eat"? Do they move in search for food?

Protozoans are heterotroph beings, i.e., they do not make their own food and therefore they require to search for it in the environment. Protozans have developed various locomotion mechanisms and they actively move towards food.

 


Related Discussions:- What do protozoans eat

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain trifluridine, Explain Trifluridine  (Viroptic)  Trifluridine is...

Explain Trifluridine  (Viroptic)  Trifluridine is a nucleoside analog active against herpes viruses, including acyclovir-resistant strains. Marketed in an ophthalmic preparatio

Define nutrition management and feeding the premature infant, Define Nutrit...

Define Nutrition Management and Feeding the Premature Infant There are numerous nutritional risk factors in premature infants. These include: Elevated metabolic rate, th

What are the hormones secreted by the adrenal cortex, Q. What are the hormo...

Q. What are the hormones secreted by the adrenal cortex? What are their respective functions? The cortical portion of the adrenals secretes hormones of the corticoid (or cortic

Determine what are the genotypes of the parents, 1. In chickens rose comb (...

1. In chickens rose comb ( R ) is dominant over single comb ( r ). A rose-combed male is mated to a rose-combed female. Eighteen chicks are produced, ten of which are rose-combed,

Explain thermal destruction of enzymes during sterilization, Explain about ...

Explain about Thermal Destruction of Enzymes during Sterilization? Before we move on to canning, we need to emphasize here that like thermal destruction of microorganisms, ther

Show the characteristics of honey, Honey comes under the purview of Prevent...

Honey comes under the purview of Prevention of Food Adulteration Act (PFA). Due to its limited production and high cost, honey is prone to adulteration by cane sugar, invert sy

Define the quantitative analysis in nutritional biochemistry, Define the Qu...

Define the Quantitative Analysis in Nutritional Biochemistry? Quantitative analysis involves the measurement of the amount of a substance present. This measurement can be done

Polyembryony, Polyembryony Presence of more than one embryo in a seed...

Polyembryony Presence of more than one embryo in a seed is termed polyembryony. The phenomenon, first discovered in orange seeds by Leeuwenhoek (1719), attracted considerable

Resource use of biodiversity, Biodiversity is multiple resource based offer...

Biodiversity is multiple resource based offering us a range of products, materials and services. Our survival and well being of man-kind is directly dependent on biodiversity. Biod

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd