What do protozoans eat, Biology

Assignment Help:

What do protozoans "eat"? Do they move in search for food?

Protozoans are heterotroph beings, i.e., they do not make their own food and therefore they require to search for it in the environment. Protozans have developed various locomotion mechanisms and they actively move towards food.

 


Related Discussions:- What do protozoans eat

Define instrument for absorbed radiation - spectrophotometer, Define Instru...

Define Instrument for Absorbed Radiation - Spectrophotometer? In contrast to colorimeter, spectrophotometer is an instrument that is capable of splitting the incident radiation

What proportion of children with down syndrome, What proportion of children...

What proportion of children with Down syndrome do you expect when women with Down syndrome have children with men who have 46 chromosomes justify your answer?

Define common complications with spinal trauma patients, Define Common comp...

Define Common complications with spinal trauma patients? Common complications with spinal trauma patients include pressure sores or decubitus ulcers, hypercalciuria and renal s

What is the importance of biotin, What is the Importance of biotin Biot...

What is the Importance of biotin Biotin is involved in a number of important metabolic reactions, probably as coenzymes. Deficiency symptoms are manifest as degenerative cha

Nitrates and nitrites- preservative, Normal 0 false false f...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Principle for presence of vanaspati and rancidity in ghee, Principle for Pr...

Principle for Presence of Vanaspati and Rancidity in Ghee Cheap edible and nonedible oils like argemone oil, white oil, tea seed oil etc. are used as adulterants in more expens

How is carbon dioxide made by producers and consumers, Q. How is carbon dio...

Q. How is carbon dioxide made by producers and consumers? The Carbon dioxide is made by consumers and producers through cellular respiration.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Heterotrophic plant, #question.name any two plants having heterotrophic mod...

#question.name any two plants having heterotrophic mode of nutrition .

What is the meaning of narcolepsy, What is the meaning of Narcolepsy Th...

What is the meaning of Narcolepsy This is an inappropriate attack of sleep, the affected person has an overwhelming impulse to fall asleep or simply collapses into sleep at inc

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd