Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are the typical vegetation and the typical fauna of the temperate forests?
In the temperate forest deciduous trees predominate. Mammals are originated in great number, as bears and deer.
Biomes - Image Diversity: temperate forests
Explain Bone Healing Process in Nutritional Care? Protein is essential for callus formation, calcification and bone healing especially in cases of orthopaedic surgery. The prot
In what ways could human activity lead to the extinction of a species in an area? Human activity could lead to extinction of a species by (a) over-hunting, e.g. elephants, rhin
in human and mammals how many cells result from oogenesis
Oogenesis Oogenesis is the formation of ovum from oogonial cells that are formed in the ovary from primordial germ cells. And as in spermatogenesis it involves meiosis to pro
how pollination occurs in Salvia?
1. By direct measurement of the activity of the thyroid gland in several patients who had received 131 I for diagnostic purposes, it was observed that the biological elimination h
Aortic Valve Repair : In, acquired AR associated with VSD and prolapse of a cusp, repair is often successful. VSD is closed and at the same time the prolapsed part o
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the clinical manifestation of the disease known as daltonism? An X-linked daltonism is a disease in which the affected individual sees the red color as green or confoun
Name three sources of energy which do not depend on fossil fuel. Sources of energy which do not rely on fossil fuel are water (hydroelectric generation), wind, tidal power, wav
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd