What are the two divisions of the angiosperms, Biology

Assignment Help:

What are the two divisions of the angiosperms?

The angiosperms are separated into monocotyledonous and dicotyledonous. (These categories are defined later in this text.)

Plant Classification - Image Diversity: monocots dicots

 


Related Discussions:- What are the two divisions of the angiosperms

Explain some weight loss during breastfeeding, Explain some Weight Loss dur...

Explain some Weight Loss during breastfeeding? Some women may want to return quickly to their pre-pregnancy weight. It is important to remember that some women will lose more,

Why heartwood differs from sapwood, Heartwood differs from sapwood in: 1...

Heartwood differs from sapwood in: 1. Presence of rays and fibres 2. Absence of vessels and parenchyma 3. Having dead and non-conducting elements 4. Being susceptible t

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Which term describes organisms which live in lake/ocean, Which term is used...

Which term is used to describe organisms that live on or in the bottom of an ocean or lake. Such organisms can be found anywhere from the shoreline to greatest ocean depths? a)

Explain fluids, Explain Fluids Fluids: Fluid diets are given to patien...

Explain Fluids Fluids: Fluid diets are given to patients with more advanced dysphasia or fractured jaws. The diet may include fruit juices, thin strained porridge with milk, e

Cell surface receptors, Hydrophilic and some lipophilic hormones bind to ce...

Hydrophilic and some lipophilic hormones bind to cell surface receptors. These are necessary  membrane  proteins  located  in the plasma  membrane  which  bind  the  signaling  mol

Diversity, who is the farther of bio diversity?

who is the farther of bio diversity?

Enumerate about the mycotic infections, Enumerate about the Mycotic Infecti...

Enumerate about the Mycotic Infections Invasion of the nervous system by a fungus is known as a mycotic infection. A fungus is any member of a large group of lower plants (in s

What are plankton, What are plankton, benthos and nekton? Plankton, ben...

What are plankton, benthos and nekton? Plankton, benthos and nekton are the three groups into which aquatic living beings may be divided. The plankton is formed by algae and

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd