Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What are the proteins? How can the protein diversity of living beings be described?
Proteins are molecules made of sequences of amino acids bound by a peptide bond.
The genetic code codifies twenty diverse amino acids that can compose proteins. So there are various combinations of amino acid which can form polypeptide chains and for this reason protein molecules can be immensely diverse.
what are the significance of zoological parks in conversation
Define phases of the absorption of iron? The process of absorption is divided into three phases: i) Iron uptake by enterocytes (epithelial cell of the superficial layer of t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is a pH meter? A pH meter is a device used for measuring. pH of any unknown solution. It is composed of: a) A reference electrode b) Glass electrode whose potential
Is monoculture a system that contributes to great biological diversity of an ecosystem? Monoculture means that in a large area a single crop (only single species of plant) is c
characteristics of protozoans
Define Food Safety and Regulation? Food sanitation because related to public health and food plant processing; FDA and USDA rules and regulations; food ingredient labelling; nu
Induction of Defensive Barriers in Plants Several polymers deposited near surface of plants form an effective barrier against invasion or stress. Cuticle (which consists of a
What are the androecium and the gynoecium? What are the other structures of flowers? Androecium is the set of male reproductive structures of flowers. It comprehends the stamen
what is the crystallization of a virus? what is the importance of this process?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd