What are the proteins, Biology

Assignment Help:

Q. What are the proteins? How can the protein diversity of living beings be described?

Proteins are molecules made of sequences of amino acids bound by a peptide bond.

The genetic code codifies twenty diverse amino acids that can compose proteins. So there are various combinations of amino acid which can form polypeptide chains and for this reason protein molecules can be immensely diverse.


Related Discussions:- What are the proteins

Biological conservation, what are the significance of zoological parks in c...

what are the significance of zoological parks in conversation

Define phases of the absorption of iron, Define phases of the absorption of...

Define phases of the absorption of iron? The process of absorption is divided into three phases: i) Iron uptake by enterocytes (epithelial cell of the superficial layer of t

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is a ph meter, What is a pH meter? A pH meter is a device used for...

What is a pH meter? A pH meter is a device used for measuring. pH of any unknown solution. It is composed of: a) A reference electrode b) Glass electrode whose potential

Determine the biological diversity of an ecosystem, Is monoculture a system...

Is monoculture a system that contributes to great biological diversity of an ecosystem? Monoculture means that in a large area a single crop (only single species of plant) is c

Define the food safety and regulation, Define Food Safety and Regulation? ...

Define Food Safety and Regulation? Food sanitation because related to public health and food plant processing; FDA and USDA rules and regulations; food ingredient labelling; nu

Induction of defensive barriers in plants, Induction of Defensive Barriers ...

Induction of Defensive Barriers in Plants Several polymers deposited near surface of plants form an effective barrier against invasion or stress. Cuticle (which consists of a

What are the androecium and the gynoecium, What are the androecium and the ...

What are the androecium and the gynoecium? What are the other structures of flowers? Androecium is the set of male reproductive structures of flowers. It comprehends the stamen

Viruses, what is the crystallization of a virus? what is the importance of ...

what is the crystallization of a virus? what is the importance of this process?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd