Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What are the pentoses? To what organic group do the pentoses belong? Are nucleotides formed of only one kind of pentose?
Carbohydrates are Pentoses made of five carbons. Deoxyribose is the pentose that constitutes ribose and DNA nucleotides is the pentose that is part of RNA nucleotides.
Q. As per the Watson - Crick Model how many polynucleotide chains does a DNA molecule have? The DNA molecule is formed by two polynucleotide chains bound in antiparallel mode (
Energy Cycle of Living Being Source of energy :All matter locks energy in the from of bonds between component molecules and atoms. This energy is the chemical ener
Q. What are the complications of chronic dyspepsia? Complications of dyspepsia are listed below: • Wright loss: Since eating most of tell provokes the symptoms, patients res
Development Projects - Deforestation The use of science and technology to support the ever- increasing needs of man is termed as development. In the recent years, the human po
Oxygen - Factors Influencing Functions of Nitrogenase Oxygen is a strong inhibitor of N 2 -fixation because it blocks both the synthesis as well as the activity of nitrogenase
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
where is the inlet and outlet of the diaylsis machine
Reproductive Cycle The whole reproductive cycle consists of an ovarian cycle and a uterine cycle. Figure illustrates one complete reproductive cycle. You can observe in the fi
What is Menu Planning? Any individual who carries the responsibility of providing meals has to take decisions regarding what to serve, how much to serve, how much to spend, whe
General requirements of implant materials 1) Biologically compatibility: an ideal implant material will elicit mainly physiological reactions within the surrounding tissues (bo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd