What are the pentoses, Biology

Assignment Help:

Q. What are the pentoses? To what organic group do the pentoses belong? Are nucleotides formed of only one kind of pentose?

Carbohydrates are Pentoses made of five carbons. Deoxyribose is the pentose that constitutes ribose and DNA nucleotides is the pentose that is part of RNA nucleotides.


Related Discussions:- What are the pentoses

Watson - crick model how many polynucleotide chains, Q. As per the Watson -...

Q. As per the Watson - Crick Model how many polynucleotide chains does a DNA molecule have? The DNA molecule is formed by two polynucleotide chains bound in antiparallel mode (

Bioenergetics, Energy Cycle  of Living Being Source of energy :All  mat...

Energy Cycle  of Living Being Source of energy :All  matter  locks  energy in the  from of   bonds  between component  molecules and   atoms. This  energy is the chemical  ener

What are the complications of chronic dyspepsia, Q. What are the complicati...

Q. What are the complications of chronic dyspepsia? Complications of dyspepsia are listed below: • Wright loss: Since eating most of tell provokes the symptoms, patients res

Development projects - deforestation, Development Projects - Deforestation ...

Development Projects - Deforestation The use of science and technology to support the ever- increasing needs of man is termed as development. In the recent years, the human po

Oxygen - factors influencing functions of nitrogenase, Oxygen - Factors Inf...

Oxygen - Factors Influencing Functions of Nitrogenase Oxygen is a strong inhibitor of N 2 -fixation because it blocks both the synthesis as well as the activity of nitrogenase

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

The kidney.., where is the inlet and outlet of the diaylsis machine

where is the inlet and outlet of the diaylsis machine

Reproductive cycle - human development, Reproductive Cycle The whole r...

Reproductive Cycle The whole reproductive cycle consists of an ovarian cycle and a uterine cycle. Figure illustrates one complete reproductive cycle. You can observe in the fi

What is menu planning, What is Menu Planning? Any individual who carrie...

What is Menu Planning? Any individual who carries the responsibility of providing meals has to take decisions regarding what to serve, how much to serve, how much to spend, whe

General requirements of implant materials, General requirements of implant ...

General requirements of implant materials 1) Biologically compatibility: an ideal implant material will elicit mainly physiological reactions within the surrounding tissues (bo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd