Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What are the main prophylactic measures against malaria?
The major preventive measures against malaria are the elimination of the treatment of infected people, vector mosquito, avoidance of the mosquito bite, information for travelers to endemic areas and the use of preventive medicines.
Organogenesis - Plant Tissue and Organ Culture Organogenesis refers to the differentiation of organs such as roots, shoots or flowers. Shoot bud differentiation may occur dire
Explain Complex or Undefined Media? Here, the exact composition of the medium is not known. It contains some complex components of plant and animal extracts whose exact chemica
Fluorescence Microscopy Certain compounds when exposed to short wavelength radiations, e.g., UV and X-rays. absorb and emit energy as light of a longer wavelength. This process o
SPERM A T OCY T OGENESIS In this process four spermatid develop from one PGC. (i) Multiplication phase The spermotogonia or sperm mother cells lie next to the b
In an adult male, which of the following is true? A. The plasma membranes of Leydig cells contain LH receptors. B. The plasma membranes of Sertoli cells contain FSH receptor
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Methodology for seliwanoff test? Take 5 ml of seliwanoff's reagent in a test tube. Add 5-6 drops of the glucose solution and heat the mixture to boiling for about 3
Nursing Assessment Hypospadias can be observed by nurse or parents at birth. The child presents with abnormal pattern of voiding and presence of chordae. The stream of ur
We are living in an unprecedented age of biological discovery and the application of biological knowledge. Programmed DNA sequencing delivered, in the year of 2001 over the 2.6
What modern technology used for the integumentary system?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd