What are the main prophylactic measures against malaria, Biology

Assignment Help:

Q. What are the main prophylactic measures against malaria?

The major preventive measures against malaria are the elimination of the treatment of infected people, vector mosquito, avoidance of the mosquito bite, information for travelers to endemic areas and the use of preventive medicines.


Related Discussions:- What are the main prophylactic measures against malaria

Organogenesis - plant tissue and organ culture, Organogenesis - Plant Tissu...

Organogenesis - Plant Tissue and Organ Culture Organogenesis refers to the differentiation of organs such as roots, shoots or flowers. Shoot bud differentiation may occur dire

Explain complex or undefined media, Explain Complex or Undefined Media? ...

Explain Complex or Undefined Media? Here, the exact composition of the medium is not known. It contains some complex components of plant and animal extracts whose exact chemica

Fluorescence microscopy, Fluorescence Microscopy Certain compounds when e...

Fluorescence Microscopy Certain compounds when exposed to short wavelength radiations, e.g., UV and X-rays. absorb and emit energy as light of a longer wavelength. This process o

Spermatocytogenesis, SPERM A T OCY T OGENESIS In this process four...

SPERM A T OCY T OGENESIS In this process four spermatid develop from one PGC. (i) Multiplication phase The spermotogonia or sperm mother cells lie next to the b

Explain the leydig cells, In an adult male, which of the following is true?...

In an adult male, which of the following is true? A. The plasma membranes of Leydig cells contain LH receptors. B. The plasma membranes of Sertoli cells contain FSH receptor

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the methodology for seliwanoff test, Explain the Methodology for se...

Explain the Methodology for seliwanoff test? Take 5 ml of seliwanoff's reagent in a test tube. Add 5-6 drops of the glucose solution and heat the mixture to boiling for about 3

Nursing assessment - hypospadias, Nursing Assessment Hypospadias can b...

Nursing Assessment Hypospadias can be observed by nurse or parents at birth. The child presents with abnormal pattern of voiding and presence of chordae. The stream of ur

What is genomics , We are living in an unprecedented age of biological ...

We are living in an unprecedented age of biological discovery and the application of biological knowledge.   Programmed DNA sequencing delivered, in the year of  2001 over the 2.6

Integumentary, What modern technology used for the integumentary system?

What modern technology used for the integumentary system?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd