What are the ions, Biology

Assignment Help:

Q. What are the ions? What are the two kinds of molecules into which ions are classified?

Ions are substances or atoms electrically charged by means of gain or loss of electrons. The two types of ions are the anions and the cations. Anions are ions with negative total electric charge and Cations are ions with positive total electric charge.


Related Discussions:- What are the ions

Explain exclusion diets, Explain Exclusion diets Exclusion diets: Speci...

Explain Exclusion diets Exclusion diets: Specific dietary exclusion becomes a necessity  in  case of  food allergy or food intolerance.  The therapeutic use of  such  diets req

Phylum platyhelminyhes, general classification of phylum platy helminthes

general classification of phylum platy helminthes

What benefits can commensalism offer to a species, What benefits can commen...

What benefits can commensalism offer to a species? Commensalism may include obtainment of food (for instance, the innocuous bacteria of the human gut), shelter or support (epip

How lysosomal enzymes involved in the scavenging of aged, How Lysosomal enz...

How Lysosomal enzymes involved in the scavenging of aged Lysosomal enzymes are also involved in the scavenging of aged and damaged cells. In several diseased states and also by

What proportion of the offspring of cross, Assuming independent assortment,...

Assuming independent assortment, what proportion of the offspring of the cross AaBbCcDd × AabbCCdd will have the aabbccdd genotype?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Horizontal chart - organization chart, Horizontal Chart: Horizontal ch...

Horizontal Chart: Horizontal chart which read from left to right are occasionally used. The pyramid lies horizontally instead of standing in the vertical position. The line of

How many cc of basaljel in the medicine cup, The doctor ordered 3 teaspoons...

The doctor ordered 3 teaspoons of Basaljel suspension in water or juice. How many cc of Basaljel (aluminum carbonate) should the nurse place in the medicine cup?

List some points to keep in mind while counselling, Q. List some points to ...

Q. List some points to keep in mind while counselling? 1. Judgment Do not be judgemental. Be a patient listener. Assess and make decision. 2. Patience and Acceptance

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd