What are the different phenotype, Biology

Assignment Help:

What is the genetic condition in which the heterozygous individual has different phenotype from the homozygous individual?

This condition is called lack of dominance and it can occur in two ways: incomplete dominance or codominance.

In incomplete dominance the heterozygous presents an intermediate phenotype among the two types of homozygous, as in sickle cell anemia in which the heterozygous produces some sick red blood cells and some normal red blood cells. Codominance occurs, for instance, in the genetic determination of the MN blood group system, in which the heterozygous has a phenotype totally dissimilar from the homozygous, not being an intermediate form.

Image Diversity: incomplete dominance codominance

 


Related Discussions:- What are the different phenotype

Procedure for spore staining in a given bacterial culture, Explain Procedur...

Explain Procedure for Spore Staining in a Given Bacterial Culture Carry out the exercise following the steps enumerated herewith 1. Take a clean, non-greasy slide. Prepare b

Special categories of hypertension, Hypertensive emergencies are one of the...

Hypertensive emergencies are one of the important categories of hypertension and characterized by severe elevations in BP that are complicated by evidence of progressive target org

Show vascular system which performs exchange of gases, Q. What is the part ...

Q. What is the part of the vascular system that performs exchange of gases and other substances with the tissues? Simply capillaries perform exchange of gases and other substan

Elaborate extracorporial in detail, Elaborate Extracorporial in detail. ...

Elaborate Extracorporial in detail. Outside of the body. An example is extracorporial digestion found in some animals where digestive enzymes are regurgitated into food. Once i

Ventilation of tracheal system – passive suction ventilation, Ventilation o...

Ventilation of Tracheal System – Passive Suction Ventilation Many active insects and insects that live in environments where water is scarce cannot depend on diffusion alone t

Identical chromatids bound, What is the structure that maintains identical ...

What is the structure that maintains identical chromatids bound? Ans) The structure that handles identical chromatids bound is the centromere.

Explain nutritional science, Explain nutritional science Dietitians ar...

Explain nutritional science Dietitians are in a 'helping' profession because the services they provide are beneficial to individuals  and society and dedicated to improving th

Instrument examination and care, Instrument Examination and Care Cleani...

Instrument Examination and Care Cleaning instruments, provides a good opportunity to examine, replace or remove damaged instruments; lubricate items such as handpieces; and oth

Tanco beans, what is the origin, uses, morphology, active constituents and ...

what is the origin, uses, morphology, active constituents and market perparations ?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd