Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is the genetic condition in which the heterozygous individual has different phenotype from the homozygous individual?
This condition is called lack of dominance and it can occur in two ways: incomplete dominance or codominance.
In incomplete dominance the heterozygous presents an intermediate phenotype among the two types of homozygous, as in sickle cell anemia in which the heterozygous produces some sick red blood cells and some normal red blood cells. Codominance occurs, for instance, in the genetic determination of the MN blood group system, in which the heterozygous has a phenotype totally dissimilar from the homozygous, not being an intermediate form.
Image Diversity: incomplete dominance codominance
Explain Procedure for Spore Staining in a Given Bacterial Culture Carry out the exercise following the steps enumerated herewith 1. Take a clean, non-greasy slide. Prepare b
Hypertensive emergencies are one of the important categories of hypertension and characterized by severe elevations in BP that are complicated by evidence of progressive target org
Q. What is the part of the vascular system that performs exchange of gases and other substances with the tissues? Simply capillaries perform exchange of gases and other substan
Elaborate Extracorporial in detail. Outside of the body. An example is extracorporial digestion found in some animals where digestive enzymes are regurgitated into food. Once i
Ventilation of Tracheal System – Passive Suction Ventilation Many active insects and insects that live in environments where water is scarce cannot depend on diffusion alone t
What is the structure that maintains identical chromatids bound? Ans) The structure that handles identical chromatids bound is the centromere.
Explain nutritional science Dietitians are in a 'helping' profession because the services they provide are beneficial to individuals and society and dedicated to improving th
Instrument Examination and Care Cleaning instruments, provides a good opportunity to examine, replace or remove damaged instruments; lubricate items such as handpieces; and oth
what is the origin, uses, morphology, active constituents and market perparations ?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd