What are pentoses, Biology

Assignment Help:

Pentoses are carbohydrates form of five carbons. Deoxyribose is the pentose that constitutes DNA nucleotides and ribose is the pentose that is part of RNA nucleotides

 


Related Discussions:- What are pentoses

What volume of water to make solution, You need to prepare 500 ml of a solu...

You need to prepare 500 ml of a solution containing 10 mM Tris, 0.15 M NaCl and 1 mg/ml SDS. At your work disposal are stock solutions containing 1 M Tris, 2.5M NaCl and 10% (w/v)

Cells, What surrounds a plant cell

What surrounds a plant cell

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Elaborates congenital aortic stenosis in details, Elaborates Congenital Aor...

Elaborates Congenital Aortic Stenosis in details? More common in males (4: 1). High incidence of Bicuspid Aortic valve. Murmur present from early infancy and sometimes at birth

What is diverticular disease, Q. What is Diverticular Disease? A common...

Q. What is Diverticular Disease? A common disorder of the large bowel, diverticulosis, is an early stage of the disease. It can be identified in 15% of the people over the age

Are there aquatic and flying mammals, Q. Are there aquatic and flying mamma...

Q. Are there aquatic and flying mammals? Sirenians (dugongs, manatees) and Cetaceans (whales, dolphins) are aquatic mammals Chiropterans (bats) are flying mammals.

What are the steps in bacterial infection, It contain four steps. They are:...

It contain four steps. They are: Attachment to host Proliferation Invasion of host tissue Toxin-induced damage to host cell

How are the proteins important in metabolism of lens, How are the proteins ...

How are the proteins important in metabolism of lens? Proteins Physical slate of protein is important for transparency of lens. Morner first time classified protein of l

How to monitor body weight to enhance athletic performance, How to monitor ...

How to monitor body weight to enhance athletic performance? Monitoring body weight is a practical way to assess energy balance. Weight stability, particularly during periods

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd