Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are halophile, thermoacidophile and methanogen archaebacteria?
There are three peculiar parts of archaebacteria. The halophile archaebacteria only survive in salt-rich environments (even salinity of the sea is not enough for them). Thermoacidophile archaebacteria are characterized by living under high temperatures and low pH. The methanogen archaebacteria are those that liberate methane gas (CH4), they are found in swamps.
Explain Fomivirsen Fomivirsen, an antisense oligonu- cleotide, is FDA-approved for intravitreal treatment of CMV retinitis in HIV-infected patients who cannot tolerate or ha
Prepare a dichotomous key the following organisms, ant, butterfly, fly, beetle, grass hopper, wasp, ladybug, roach and dragonfly
Classification of Protozoa Traditionally, protozoans have been classified as flagellates, amoebae, sporozoans and ciliates. We have retained this broad grouping for convenienc
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Meaning of Gestational Diabetes Mellitus? In this type of diabetes, increased blood sugar level is first diagnosed or recognized during pregnancy. Women are not known as dia
Determine sequence weights for the sequences ACTA, ACTT, CGTT, and AGAT in problem 1 by using Thompson, Higgins, and Gibson method
point out the criticism of lamarckism in any six short points.
Precautions to prevent from HIV To avoid HIV infection one should practice safe sex (use of condoms). Besides a few simple precautions are given for protection against HIV inf
Phosphorus Cycle - Nutrient Cycles Phosphorus is a very important nutrient because of its role in the form of phosphate, in reactions that store and release energy. The availa
Explain the Peptones - Complex Media? Peptones are protein hydrolysates obtained by partial digestion of meat, casein, soya meal, gelatin or other protein source. These provide
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd