What are extraembryonic membranes, Biology

Assignment Help:

What are extraembryonic membranes?

Extraembryonic membranes are membranous structures that appear in parallel with the embryo and play significant roles in the embryonic development.

They form from the embryo but do not become part of the individual organism after its birth.

 


Related Discussions:- What are extraembryonic membranes

Initiation codon, Initiation Codon is the codon at which the translation o...

Initiation Codon is the codon at which the translation of a polypeptide chain is initiated. This is generally the first AUG triplet in the mRNA molecule from 5' end, where the rib

What is implant failure, What is Implant Failure The total failure of t...

What is Implant Failure The total failure of the implant to fulfill its purpose which are functional, esthetic and phonetic because of mechanical or biologic reasons.

Explain cell cycle, Q. What is the cell cycle? The Cell cycle, or mitot...

Q. What is the cell cycle? The Cell cycle, or mitotic cycle, is the time period that begins when the cell is finishes and created when it is divided by mitosis creating two dau

Rna editing, RNA  editing  is  the  name  given  to  several  reactions  wh...

RNA  editing  is  the  name  given  to  several  reactions  whereby  the  nucleotide series  on an mRNA  molecule  should  be modified  by mechanisms  other  than RNA  splicing.  T

Explain precautions for morphological study of fungi, Explain Precautions f...

Explain Precautions for Morphological Study of Fungi? 1. Use sterile forcep and needles for slide culture technique. 2. Aseptic conditions should be maintained.  3. Caref

Atp molecules produced for each glucose molecule, Q. How many ATP molecules...

Q. How many ATP molecules are produced for every glucose molecule used in fermentation? And How many ATP molecules are produced for each glucose molecule used in aerobic respiratio

Blood sugar assessment, The measurement of blood sugar is of prime importan...

The measurement of blood sugar is of prime importance in the diagnosis and monitoring of patients with diabetes. You can refer sub-section 1.5.2 of Unit 1 to review about Glucose T

Difference between artificial and natural selection, Difference between Art...

Difference between Artificial selection and natural selection - S.No Artificial selection Natural selection 1. It

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Importance of primary prevention of diabetes mellitus, Q. Importance of Pri...

Q. Importance of Primary prevention of diabetes mellitus ? Primary prevention has been found to be cost effective in the long run as it reduces unwarranted human suffering. Pre

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd