Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are extraembryonic membranes?
Extraembryonic membranes are membranous structures that appear in parallel with the embryo and play significant roles in the embryonic development.
They form from the embryo but do not become part of the individual organism after its birth.
Initiation Codon is the codon at which the translation of a polypeptide chain is initiated. This is generally the first AUG triplet in the mRNA molecule from 5' end, where the rib
What is Implant Failure The total failure of the implant to fulfill its purpose which are functional, esthetic and phonetic because of mechanical or biologic reasons.
Q. What is the cell cycle? The Cell cycle, or mitotic cycle, is the time period that begins when the cell is finishes and created when it is divided by mitosis creating two dau
RNA editing is the name given to several reactions whereby the nucleotide series on an mRNA molecule should be modified by mechanisms other than RNA splicing. T
Explain Precautions for Morphological Study of Fungi? 1. Use sterile forcep and needles for slide culture technique. 2. Aseptic conditions should be maintained. 3. Caref
Q. How many ATP molecules are produced for every glucose molecule used in fermentation? And How many ATP molecules are produced for each glucose molecule used in aerobic respiratio
The measurement of blood sugar is of prime importance in the diagnosis and monitoring of patients with diabetes. You can refer sub-section 1.5.2 of Unit 1 to review about Glucose T
Difference between Artificial selection and natural selection - S.No Artificial selection Natural selection 1. It
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Importance of Primary prevention of diabetes mellitus ? Primary prevention has been found to be cost effective in the long run as it reduces unwarranted human suffering. Pre
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd