Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Enzymes are proteins that are catalysts of chemical reactions. From Chemistry, it is called that catalysts are non-consumable substances that decrease the activation energy essential for a chemical reaction to occur.
Enzymes are highly particular to the reactions they catalyze. They are of essential importance for life because most part of chemical reaction of the cells and tissues are catalyzed by enzymes. Without enzymatic action, those reactions would not happen or would not happen in the needed speed for the biological processes in which they participate.
How does nondisjunction in meiosis I and meiosis II look in males and females? Diagram it.
Respiration Robert Boyel and Robert Hook first of all explained the meaning of respiration. Main aim of respiration is to liberate energy in the form of A.T.P. Oxidati
Q. What is the respective importance of water, carbon and nitrogen for living beings? Water is the major solvent of living beings and it is necessary practically for all bioche
Explain Transport and Utilization of Vitamin A? The efficacy of the intestines to facilitate absorption and utilization of retinoid s and carotenoids depends upon the cellular
K.L. is a 30-year-old Caucasian male was brought to Emergency Department (ED) after a bicycle accident. He was hit from behind by a compact car traveling at 35 miles per hour. On
Define Nutritional Needs during Exercise? During Exercise: Addressing the nutritional needs during training is essential for optimal performance. The focus should be to:
What is the function of the citric acid cycle? The hnction ofthe citric acid cycle can be discussed as follows. The intermediates of citric acid cycle are used as precursor
Digestion of fats A. Production of bile salts in the liver and the secretion of those bile salts into the small intestine. B. Production of lipase in the pancreas and
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
The Km for an enzyme A. is equal to kcat, measured at low substrate concentration. B. is the substrate concentration that gives a velocity that is half the maximum velocity.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd