What are enzymes?, Biology

Assignment Help:

Enzymes are proteins that are catalysts of chemical reactions. From Chemistry, it is called that catalysts are non-consumable substances that decrease the activation energy essential for a chemical reaction to occur.

Enzymes are highly particular to the reactions they catalyze. They are of essential importance for life because most part of chemical reaction of the cells and tissues are catalyzed by enzymes. Without enzymatic action, those reactions would not happen or would not happen in the needed speed for the biological processes in which they participate.

 


Related Discussions:- What are enzymes?

How nondisjunction in meiosis i and meiosis ii look in males, How does nond...

How does nondisjunction in meiosis I and meiosis II look in males and females? Diagram it.

Respiration in animals, Respiration Robert Boyel and Robert Hook fir...

Respiration Robert Boyel and Robert Hook first of all explained the meaning of respiration. Main aim of respiration is to liberate energy in the form of A.T.P. Oxidati

Importance of water - carbon and nitrogen for living beings, Q. What is the...

Q. What is the respective importance of water, carbon and nitrogen for living beings? Water is the major solvent of living beings and it is necessary practically for all bioche

Explain transport and utilization of vitamin a, Explain Transport and Utili...

Explain Transport and Utilization of Vitamin A? The efficacy of the intestines to facilitate absorption and utilization of retinoid s and carotenoids depends upon the cellular

Pneumothorax, K.L. is a 30-year-old Caucasian male was brought to Emergency...

K.L. is a 30-year-old Caucasian male was brought to Emergency Department (ED) after a bicycle accident.  He was hit from behind by a compact car traveling at 35 miles per hour.  On

Define nutritional needs during exercise, Define Nutritional Needs during E...

Define Nutritional Needs during Exercise? During Exercise: Addressing the nutritional needs during training is essential for optimal performance. The focus should be to:

What is the function of the citric acid cycle, What is the function of the ...

What is the function of the citric acid cycle? The hnction ofthe  citric acid cycle can be discussed as  follows. The  intermediates of citric acid cycle are used as  precursor

Digestion of fats, Digestion of fats   A.  Production of bile salts in ...

Digestion of fats   A.  Production of bile salts in the liver and the secretion of those bile salts into the small intestine.   B.  Production of lipase in the pancreas and

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

The km for an enzyme is equal to kcat, The Km for an enzyme A. is equal ...

The Km for an enzyme A. is equal to kcat, measured at low substrate concentration. B. is the substrate concentration that gives a velocity that is half the maximum velocity.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd