What are deciduous trees, Biology

Assignment Help:

What are deciduous trees?

The Deciduous trees are plants that lose their leaves in a period of the year and in the case of the deciduous trees of the temperate forest the fall of the leaves occurs in the autumn (fall). The losing of leaves is a preparation to face the cold months of the winter: stem roots and branches are more resistant to low temperature and snow than the leaves; without leaves the metabolic rate of the plant is reduced; the decaying fallen leaves help to nourish the soil.

 


Related Discussions:- What are deciduous trees

Name the two groups of nephrons, Name the two groups of nephrons on the bas...

Name the two groups of nephrons on the basis of their position in the kidney. How are they different from each other? a) How is the halophyte Rhizophora adapted to survive in i

Isolation techniques, Differentiate between spread plating and streaking?

Differentiate between spread plating and streaking?

Define the public nutrition, Define the Public Nutrition Public nutriti...

Define the Public Nutrition Public nutrition is concerned with improving nutrition in populations in both poor and industrialized countries, linking with continuity and public

Abandonment of the ammoniotelic excretion, Q Why after the passage of anima...

Q Why after the passage of animals from the aquatic to the terrestrial habitat does the abandonment of the ammoniotelic excretion occur? Ammonia is a highly toxic molecule if n

Define rna synthesis , The general mechanism of RNA synthesis by these euk...

The general mechanism of RNA synthesis by these eukaryotic RNA polymerases is the same as for the prokaryotic enzyme that is: ?   The initiation  of RNA synthesis  by RNA polyme

Human impact on nitrogen cycle , Human Impact on Nitrogen Cycle Human...

Human Impact on Nitrogen Cycle Human activities are profoundly affecting the cycling of nitrogen in nature. Over 30 x 10 6 metric tons/yr. of N 2 is fixed in the commercial

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about the lactation process, Explain about the Lactation Process? ...

Explain about the Lactation Process? Lactation is a physiologic process which has profound relevance for both the mother and the newborn. It is the period following pregnancy w

Glucocorticoid response element, GRE  stands for the Glucocorticoid Respons...

GRE  stands for the Glucocorticoid Response Element: The binding site in a promoter to which the activated glucocorticoid receptor can be bind. The glucocorticoid receptor is signi

Palliative and corrective procedures for cyanotic congenital, Palliative Pr...

Palliative Procedures   i)  This consists of enlarging the existing for a men ovale by putting a baloon through the defect (baloon septostomy) so that interatrial mixing of blo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd