Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are coacervates?
Coarcervates are small structures made of the aggregation of organic molecules under water solution. By electrical attraction the molecules join into bigger and more organized particles separate from the fluid environment forming a membrane-like structure that divides an internal region of the coacervate from the exterior. The coacervates might separate themselves and also absorb and excrete substances. It is believed that these structures might have been the precursors of cells.
Define Reagents for Determination of the Saponification Number of Fats? 0.5 N alcoholic KOH 0.5 N HCI Solid sodium carbonate 1% alcoholic solution of methyl orange
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Objective of nutrient needs during periods of pregnancy? describe the various physiological changes during pregnancy, describe foetal growth and development and
Explain nutritional science Dietitians are in a 'helping' profession because the services they provide are beneficial to individuals and society and dedicated to improving th
You have two enzymes, 1 and 2. Both convert substance A into substance B. 1 is inhibited by B, because B partially blocks the active site and will not allow more A to enter. 2 is i
Q. What are the cytochromes? Cytochromes are proteins of the interior mitochondrial membrane that are specialized in electron transfer and participate in the respiratory chain.
Q Sponge identity card. How are sponges characterized according to example of representing beings, basic morphology, type of symmetry, embryonic (germ) layers and coelom, digestive
CALCIUM It is the most abundant mineral of animal body. Calcium is available in all types of vegetables, grain, milk, cheese, eggs, fish and butter. By its deficiency r
P r o s p ec ts of meat products The demand for convenience meat based fast food is ever increasing due to rapid industrialization and urbanization, higher standards of l
Head - check for size, shape or fontanelles, caput, or any other abnormality. Fontanel - anterior fontanel is diamond shaped having size of 2.5 - 4.5 cms. It close
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd