Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are bacteriophages?
Bacteriophages are viruses specialized in parasitism of bacteria. They are used in genetic engineering as molecular cloning vehicles to insert recombinant DNA into bacteria. They were also used in the former Soviet Union to treat bacterial infections.
Bacteriophages have a polyhedron-like capsid and DNA as genetic material. The "head" of the virus is linked to a tail that ends in small fibers that help the virus to attach to the bacterial cell wall and to inject its genetic material into the host.
Virus Review - Image Diversity: bacteriophage
Trypanosomes – Flagellates The trypanosomes are among the serious pathogens that cause high mortality among human populations and domestic animals in Africa and also in South
Three point charges are located at the corners of an equilateral triangle. Find the magnitude and direction of the net electric force on the 1.60 uC charge. (Let A = 1.60 uC, B= 6.
If a male who is heterozygous for an autosomal trait mates with a female who is also heterozygous for that trait, what percent of their offspring are probable to be heterozygous fo
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Surgical preparation of the bone - drill technique It is essential not to allow the bone to be heated above 47°C during preparation of the site as this will cause bone cell dea
Nitrogen Cycle The nitrogen is an essential constituent of protein - the building block of all living cells. It is also a major constituent of the atmosphere (79 per cent). Al
Q. Explain nutrient requirements during hypertension? In order to meet the above objectives, we need to understand the nutrient requirements during hypertension. Let us start w
WHAT IS IMPORTANT VALUE INDEX OF PLANT
What is the ranges of tolerance and performance optima? Ranges of Tolerance and Performance Optima : When it comes to physical factors or resources, most species are able to
Q. Why is waste considered one of the major environmental issues? The environmental problem regarding waste worsens with industrial development and the global growth of consump
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd