What are bacteriophages, Biology

Assignment Help:

What are bacteriophages?

Bacteriophages are viruses specialized in parasitism of bacteria. They are used in genetic engineering as molecular cloning vehicles to insert recombinant DNA into bacteria. They were also used in the former Soviet Union to treat bacterial infections.

Bacteriophages have a polyhedron-like capsid and DNA as genetic material. The "head" of the virus is linked to a tail that ends in small fibers that help the virus to attach to the bacterial cell wall and to inject its genetic material into the host.

Virus Review - Image Diversity: bacteriophage

 


Related Discussions:- What are bacteriophages

Trypanosomes – flagellates, Trypanosomes – Flagellates The trypanosome...

Trypanosomes – Flagellates The trypanosomes are among the serious pathogens that cause high mortality among human populations and domestic animals in Africa and also in South

What is the magnitude n, Three point charges are located at the corners of ...

Three point charges are located at the corners of an equilateral triangle. Find the magnitude and direction of the net electric force on the 1.60 uC charge. (Let A = 1.60 uC, B= 6.

Explain offspring of heterozygous for autosomal trait mates, If a male who ...

If a male who is heterozygous for an autosomal trait mates with a female who is also heterozygous for that trait, what percent of their offspring are probable to be heterozygous fo

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine surgical preparation of the bone - drill technique, Surgical prep...

Surgical preparation of the bone - drill technique It is essential not to allow the bone to be heated above 47°C during preparation of the site as this will cause bone cell dea

Nitrogen cycle, Nitrogen Cycle The nitrogen is an essential constituen...

Nitrogen Cycle The nitrogen is an essential constituent of protein - the building block of all living cells. It is also a major constituent of the atmosphere (79 per cent). Al

Explain nutrient requirements during hypertension, Q. Explain nutrient requ...

Q. Explain nutrient requirements during hypertension? In order to meet the above objectives, we need to understand the nutrient requirements during hypertension. Let us start w

What is the ranges of tolerance and performance optima, What is the ranges ...

What is the ranges of tolerance and performance optima? Ranges of Tolerance and Performance Optima :   When it comes to physical factors or resources, most species are able to

Why waste considered major environmental issues, Q. Why is waste considered...

Q. Why is waste considered one of the major environmental issues? The environmental problem regarding waste worsens with industrial development and the global growth of consump

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd