Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
At the present level of the biotechnology what are the main techniques of genetic engineering? The major techniques of genetic engineering today are: the recombinant DNA techno
How membrane maintained impermeability to potassium At 1 AM, an impermeable membrane divides a 1 liter solution of 1M NaCl in the left compartment from a 1 liter solution havin
before stem cuttings are planted the cut end of the stem is often dipped in a hormone powder .what is the point of this?
Heifers As efficient reproductive performance is essential for economic livestock production, the female calves must grow rapidly to attain sexual maturity, ovulate and be mated b
Define the Gel Electrophoresis? Gel electrophoresis is among the most powerful and yet conveniently used methods of macromolecular separation. The gels in common use, polyacryl
What are the flat bones and the long bones? The major bones of the body may be divided as flat or long bones (there are bones not classified into these categories). Such as fla
Does the fish heart pump venous or arterial blood? The venous blood coming from the tissues enters the atrium and passes to the ventricle that then pumps the blood towards the
When William was helping victims following a devastating earthquake in a region that was not prepared to swiftly set up adequate temporary shelter, he developed severe diarrhea. He
How is the gastric mucosa protected from the acid pH of the stomach? The gastric epithelium is mucus secretory, i.e., it makes mucus. The mucus covers the stomach wall preventi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd