Vitellogenesis, Biology

Assignment Help:

Vitellogenesis

Vitellogenesis is the stage where much of the oocyte growth occurs. The completion of second maturation division (meiosis), which may occur after ovulation, results in ripe egg or ovum. In some species such as sea urchins and frogs, the female produces hundreds or thousands of eggs at a time where as in most mammals including humans only a few eggs are produced in the entire lifetime of the individual. In this section we shall discuss oogenesis in two groups of animals,

 (1) The amphibians as an example of organisms which produce yolky eggs and

 (2) Mammals, as an example of organisms whose eggs do not contain any yolk.


Related Discussions:- Vitellogenesis

Explain about oral glucose tolerance test, Q. Explain about Oral Glucose To...

Q. Explain about Oral Glucose Tolerance Test? This is most commonly used diagnostic test particularly for identifying new and ‘at risk' individua1s.Thi.s test is carried out af

Erythrocytic cycle, Erythrocytic cycle The cycle that takes place i...

Erythrocytic cycle The cycle that takes place in the body of man who is considered as secondary host is called the erythrocytic cycle. The first stage of the cycle begins

Modification of mitosis, MODIFICATION OF MITOSIS 1 .      CRYPTOMITOS...

MODIFICATION OF MITOSIS 1 .      CRYPTOMITOSIS OR PROMITOSIS : Primitive type of mitosis. In this mitosis nuclear membrane not disappear (remain intact throughout the div

Nutrition, Why is holophytic nutrition a mode of autotrophic nutrition

Why is holophytic nutrition a mode of autotrophic nutrition

Mechanism of movement of chromosomes, The movement of the chromosome is cal...

The movement of the chromosome is called anaphase A, and the extension of the poles is termed anaphase B.The mechanism of these movements are discussed below. Chromosome move

Explain the digestion of carbohydrates, Explain the Digestion of carbohydra...

Explain the Digestion of carbohydrates? You are aware that 60-70% of energy is supplied by the dietary carbohydrates which are primarily present as polysaccharides (starch) fol

Differences between vertebrates and the other chordates, What are the diffe...

What are the differences between vertebrates and the other chordates? Vertebrates are dissimilar because they have a spinal column (vertebral column). In these animals the noto

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Special categories of hypertension, Hypertensive emergencies are one of the...

Hypertensive emergencies are one of the important categories of hypertension and characterized by severe elevations in BP that are complicated by evidence of progressive target org

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd