Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Vitellogenesis
Vitellogenesis is the stage where much of the oocyte growth occurs. The completion of second maturation division (meiosis), which may occur after ovulation, results in ripe egg or ovum. In some species such as sea urchins and frogs, the female produces hundreds or thousands of eggs at a time where as in most mammals including humans only a few eggs are produced in the entire lifetime of the individual. In this section we shall discuss oogenesis in two groups of animals,
(1) The amphibians as an example of organisms which produce yolky eggs and
(2) Mammals, as an example of organisms whose eggs do not contain any yolk.
Q. Explain about Oral Glucose Tolerance Test? This is most commonly used diagnostic test particularly for identifying new and ‘at risk' individua1s.Thi.s test is carried out af
Erythrocytic cycle The cycle that takes place in the body of man who is considered as secondary host is called the erythrocytic cycle. The first stage of the cycle begins
MODIFICATION OF MITOSIS 1 . CRYPTOMITOSIS OR PROMITOSIS : Primitive type of mitosis. In this mitosis nuclear membrane not disappear (remain intact throughout the div
Why is holophytic nutrition a mode of autotrophic nutrition
The movement of the chromosome is called anaphase A, and the extension of the poles is termed anaphase B.The mechanism of these movements are discussed below. Chromosome move
Explain the Digestion of carbohydrates? You are aware that 60-70% of energy is supplied by the dietary carbohydrates which are primarily present as polysaccharides (starch) fol
What are the differences between vertebrates and the other chordates? Vertebrates are dissimilar because they have a spinal column (vertebral column). In these animals the noto
porifera canal system skeleton
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Hypertensive emergencies are one of the important categories of hypertension and characterized by severe elevations in BP that are complicated by evidence of progressive target org
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd