Vitamin - d, Biology

Assignment Help:

VITAMIN - D

  1. Also known as Calciferol / Anti ricket vitamin / sun shine vitamin.
  2. It is necessary for bones & teeth.
  3. It is synthesized in presence of UV rays of sunlight in the skin.
  4. It regulates absorption of calcium & phosphorus.
  5. Cod liver oil is the best source of vitamin D.
  6. Other sources are spleen, egg & milk.
  7. Deficiency of vitamin D causes rickets in children (bending & swelling of joint leading to bow legs, pigeon chest)
  8. Deficiency of vitamin D causes ostiomalesia (softening of bone) in adults.

Related Discussions:- Vitamin - d

What is a population, Q. What is a population? In the Biology a populat...

Q. What is a population? In the Biology a population is a set of individuals of the same species living in a given place and in a given time.

Exercise- heat production, Exercise- Heat Production During physical ...

Exercise- Heat Production During physical activity heat production by exercise can to some extent substitute for heat generated by shivering. However, exercise also tends to

Off pump coronary artery bypass surgery opcab, Application :  Off Pump...

Application :  Off Pump Coronary Artery Bypass Surgery (OPCAB) CABG is done on epicai-dial vessels. Cardio pulmonary by pass is used only to get a still h

Describe how to analysis and evaluation of jvp, Describe how to Analysis an...

Describe how to Analysis and Evaluation of JVP ? 1) Elevated: Any cause producing right ventricular, failure or in pericardial effusion and in constrictive pericardiitis when p

Management of hypertension, Q. Management of hypertension? the manageme...

Q. Management of hypertension? the management of hypertension, angina pectoris and myocardial infarction. It must be clear to you that some aspects of dietary management may di

Mechanism of enzyme action, Mechanism  of Enzyme Action  The action of...

Mechanism  of Enzyme Action  The action of enzymes is to lower  the activation energy  or threshold  of their substrates which. Therefore  become  activated and   react  with

Explain nutrition or diet counseling, Explain Nutrition or diet counseling ...

Explain Nutrition or diet counseling Nutrition or diet counseling  is a  primary educational activity  of  the dietitian.  It incorporates the idea of working with a patient, e

Lens - organogenesis of eye and limb, Lens - Organogenesis of Eye and Limb ...

Lens - Organogenesis of Eye and Limb There is much experimental proof that the lens formation in many species is dependent on the induction by the optic vesicle while it conta

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Illustrate briefly about vitamin B6, Vitamin B 6 (Pyridoxine hydrochloride...

Vitamin B 6 (Pyridoxine hydrochloride) Pyridoxine hydrochloride is a white, crystalline powder, practically odourless. The dry substance is sufficiently stable in air. With pr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd