vitamin, Biology

Assignment Help:
fish liver oil is rich in which vitamin ???

Related Discussions:- vitamin

What are phospholipids, What are phospholipids? Phospholipids are molec...

What are phospholipids? Phospholipids are molecules made of glycerol bound to two long molecules of fatty acids and to one phosphate group. Thus, phospholipids are amphipathic

Define drug effects on carbohydrate metabolism, Define drug effects on Carb...

Define drug effects on Carbohydrate metabolism? Carbohydrate metabolism: Hypoglycemic drugs such as insulin and sulphonylureas are prescribed because of their ability to increa

Explain stavudine, Explain Stavudine It can be given either in initial ...

Explain Stavudine It can be given either in initial combination therapy or after failure of regimens containing other NRTIs. Cross-resistance with zidovudine is frequent, ho

What is global warming, What is global warming? Global warming is the e...

What is global warming? Global warming is the enhance in the temperature of the planet due to accumulation of some gases in the atmosphere, especially gases that retain the sol

Keel, keel is the characteristic feature of flower of 1.tomato 2. tulip 3.u...

keel is the characteristic feature of flower of 1.tomato 2. tulip 3.ubdugifera 4.aloe

Define standard or total plate counts (spc/tpc), Define Standard or Total P...

Define Standard or Total Plate Counts (SPC/TPC)? It is the most widely used method to know the microbiological quality of the food sample. It is quick and efficient method, giv

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define gastrointestinal tract - excretion of zinc in humans, Define Gastroi...

Define Gastrointestinal tract - Excretion of Zinc in Humans? Majority of zinc is lost from the body in faeces. Endogenous zinc in the form of enzymes or metallo-proteins is sec

Biosecurity in poultry health management, B i osecurity in Poultry Health...

B i osecurity in Poultry Health Management Biosecurity includes all the measures that are taken to prevent infection to individual, material and environment from the pathogen

Explain the pre pregnancy height and foetal outcome, Explain the Pre Pregna...

Explain the Pre Pregnancy Height and Foetal Outcome? Maternal height prior to conception, determined by heredity, socio-economic environment and maternal nutritional status, is

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd