Viscosity - blood flow, Biology

Assignment Help:

Viscosity - Blood Flow

The resistance to flow in a tube results from inner friction in the fluid i.e. the viscosity. We all know that water and sugar syrup do not flow at the same rate from a bottle. We can say that water has low viscosity and syrup, a high viscosity. For convenience viscosity of a fluid is expressed relative to the viscosity of water. Blood plasma has a relative viscosity of 1.8 mostly as a result of the 7% dissolved proteins. Whole blood is more viscous because of the cells in it, at 37?C, relative viscosity of mammalian blood is between 3 and 4. Therefore, because of the presence of RBC blood behaves as though it is 3-4 times more viscous than water. However, blood does not behave as expected of a viscous fluid.

Its relative viscosity changes with decreasing radius of the blood vessels. In fact in tubes less than 0.3 mm in diameter the relative viscosity of blood approaches that of the plasma, therefore, it flows more easily. In flowing blood, we find that the red cells tend to accumulate in the centre. This accumulation leaves the wall relatively free of cells, therefore, the viscosity in the centre is more than at the sides. Since flow is inversely related to viscosity, flow at the walls will increase slightly and will decrease at the centre slightly. Another peculiar aspect of blood flow in capillaries is that often the capillary diameter is smaller than RBC and the RBCs easily change shape to pass through the capillary. This gives rise to a very different type of flow - bolus flow in which the red cells act as a plug that causes rapid increase in liquid along the walls of the capillary and thus help in the renewal of the diffusible substances in this layer.


Related Discussions:- Viscosity - blood flow

Class bivalvia, Class Bivalvia Body in a bilohed mantle enclosed in a...

Class Bivalvia Body in a bilohed mantle enclosed in a two-valved shell; head reduced; mouth with labial palps but no radula; foot wedge-shaped; plate-like gills; sexes separa

Accidents resulting in death, Accidents Resulting in Death Accidents t...

Accidents Resulting in Death Accidents that cause death are dealt with in a different way. The law requires full compensation to the widow for complete life or until remarriag

How are lipids classified, Regarding solubility, how are lipids classified?...

Regarding solubility, how are lipids classified? Fats and oils are hydrophobic molecules, i.e., they are non polar and insoluble in water. Lipids in general are molecules with

Mortality - population parameters and regulation, Mortality - Population Pa...

Mortality - Population Parameters and Regulation The death of an individual in a population is known as mortality. Mortality rate like natality rate can be expressed as the nu

Explain the life history of lycophytes, Explain the Life History of Lycophy...

Explain the Life History of Lycophytes? Lycophytes have two separate and distinct generations in their life history that alternate with each other. The gametophyte stage is tin

Explain about oil-bearing fruits, Explain about Oil-bearing fruits Oil-...

Explain about Oil-bearing fruits Oil-bearing fruits, nuts and seeds have been grown and used for food for many centuries. More than 100 varieties of plants are known to have oi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the parts of a surgical needle, What are the parts of a surgical n...

What are the parts of a surgical needle. How do you classify surgical needles The surgical needle is comprised of 3 parts: the needle point, the needle body, and the swaged (pr

Accident proneness, Accident Proneness The close observation of accid...

Accident Proneness The close observation of accident causation theory brings out this fact that most accidents can be traced to error on the part of a number of individual em

Explain cardiac examination auscultation and its techniques, Explain cardia...

Explain cardiac examination auscultation and its techniques? Auscultation of the heart sound and associatcd sound is very important to diagnose the cardiovascular diseases. It

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd