Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the major evolutionary novelty presented by annelids? The main evolutionary novelty presented by the beings of the phylum Annelida is the coelom, the internal body c
Ovary is half-inferior in the flowers of : 1. Guava 2. Plum 3. Brinjal 4. Cucumber Plum is the flower in which ovary is half - inferior
Explain G.I. (Gastro-Intestinal) system? A. Skeletal muscles directly control the movement of substances at the entrance of the G.I. system. B. Smooth muscles control the mo
Minerals :- Zinc Food Source Meats, cereals. Nutritional Functional role Essential nutrient: Deficiency produces loss of appetite, growth retardation, skin
Can you complete this in 24hrs
Which one of the following is used as vector for cloning genes into higher organisms ? 1. Baculovirus 2. Salmonella typhimurium 3. Rhizopus nigricans 4. Retrovirus
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Regulation and Excretion of sodium and chloride? Renal excretion and retention of these elements is closely regulated. The total content of body sodium especially the co
Explain the Digestibility Coefficient? You have earlier learnt that dietary proteins are hydrolyzed to amino acids during digestion. The digestion begins in the stomach by the
Q. Explain Tricuspid regurgitation? Though tricuspid regurgitation is a common valvular abnormality on echocardiography rarely is it due to primary organic disease. Secondar
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd