Vertebrate limb, Biology

Assignment Help:

Vertebrate Limb

Earlier we know that how a series of sequential and coordinated interactions between different cell groups and tissues carry about the construction of a complex organ, the vertebrate eye. In this we will study the development of other complex organ, the vertebrate limb. The paired limbs of all tetrapod vertebrates are made on a common basic pattern, develop in similar manner from cells derived from identical sources in the embryo and, hence, they are all homologous structures. An extremely large number of descriptive and experimental studies have been done on development in vertebrates throughout the present century.

At first the work was done mostly on amphibian embryos but later the chick has been chosen for, among other reasons, the chick embryos are large, easily accessible and obtainable throughout the year. As recently much experimental work has been done on the development of wing of chick embryos. The wing bud is comparatively a large structure and can be manipulated in several ways by the investigator. Portions of the bud can be cut out and their development studied through grafting them in the same or different embryos or on chorioallantoic membrane of older chick embryos. Its mesodermal and ectodermal components can be separated from each other by treatment along with some chemicals like trypsin, EDTA etc or microsurgery and then they can be reassembled readily in different combinations. The two components of such type of synthesized buds can be from the same or different limb types, from embryos of similar or different stages, of the same or different species. The development of such types of combinations can be studied by grafting them on embryos or chorioallantoic membrane or culturing them in vitro. Much of our understanding about the mechanisms involved in limb development has come from investigations on such studies on chick embryos.


Related Discussions:- Vertebrate limb

Explain the technology of transgenic plant, Explain the technology in which...

Explain the technology in which transgenic plant was constructed in which seeds that will produce plants for a single crop.

Amount of proteins present in the cell, Cells regulate their level of activ...

Cells regulate their level of activity by regulating the amount of proteins present in the cell at any given time, so an up regulation of enzymes would be expected to A. increase t

What is nerve impulses in human biology, What is Nerve Impulses in human bi...

What is Nerve Impulses in human biology? A nerve impulse is an electrical signal carried by a nerve cell. Unlike electrical transmission in wires, this impulse is non-decremen

Define water of oxidation or metabolic water, Define Water of oxidation or ...

Define Water of oxidation or metabolic water? Water that arises from oxidation of foods within the body, which is referred to as water of oxidation or metabolic water. Water wh

Explain glycogen storage diseases, Glycogen Storage Diseases Glycogen  ...

Glycogen Storage Diseases Glycogen  storage diseases are caused by  genetic defects that result  in  deficiencies in  certain enzymes of  glycogen metabolism. These deficiencie

Define physical activity as a factor for obesity, Define Physical activity ...

Define Physical activity as a factor for obesity? Sedentary life style with lack of an exercise schedule tends to make one obese. As we approach middle age, our physical activi

What are the problems that vertebrates required, What are the problems that...

What are the problems that vertebrates required to solve to adapt to the terrestrial environment as they came from the aquatic habitat? How evolution does solve those problems?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain composition of malt yeast peptone glucose medium, Explain Compositi...

Explain Composition of Malt Yeast Peptone Glucose Medium? Malt Extract - 3.0 gm Yeast Extract - 3.0 gm Peptone - 5.0 gm Glucose - 10.0 gm Agar - 15.0 gm Distille

Why is the uricotelic excretion essential for reptile, Q. Why is the uricot...

Q. Why is the uricotelic excretion essential for reptile and avian embryos? In birds and reptiles the excretory system is uricotelic since uric acid is less toxic, insoluble an

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd