Vertebrate kidney, Biology

Assignment Help:

Vertebrate Kidney

Typically, all vertebrates have a pair of kidneys, which function on the filtration - reabsorption - secretion principle. Only in a few teleost fishes, the kidney is aglomerular (without a glomerulus) and functions on the absorption - reabsorption - secretion principle as in the malpighian tubules of insects. The functional unit of the vertebrate kidney is the nephron or the uriniferous tubule. A small fish may have only a few dozen nephrons in its kidneys; a large mammal may have several million.  A mammalis nephron begins with the renal corpuscle or the Malpighian body which consists of a double-walled cup, the Bowman's capsule, enclosing a knot of blood capillaries called glomeplus.

359_Vertebrate Kidney.png

Figure:  Schematic diagram of mammalian kidney and nephoron

Blood is brought to the kidney by the renal artery which branches and sub-branches into interloper arteries and finally into the afferent arteriole which gives rise to the capillary network of the glomerulus. An efferent arteriole formed by the confluence of the capillaries takes blood away from the Bowman's capsule. The Bowman's capsule latter continues into a long convoluted tubule which is distinguished into the proximal and distal convoluted tubules respectively. The distal convoluted tubules from different nephorons join to form the collecting tubule which carry the urine into the renal pelvis from where the ureter starts. The proximal and distal tubules are present in all vertebrates, but in birds and mammals a new U-shaped hair-pin-like segment called Henle's loop is present between proximal and the distal tubules. In the following section we shall study structural variations in the vertebrate kidney.


Related Discussions:- Vertebrate kidney

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe the developmental periods of coronary artery diseas, Describe the ...

Describe the Developmental Periods of coronary artery diseases? The development of coronary artery disease like many other diseases can be divided into the following periods:

Historic example of evolutionary quantitative geneticists, Define Historic ...

Define Historic Example of Evolutionary quantitative geneticists? Evolutionary quantitative geneticists have developed tools to create predictions about the short-range evoluti

Study giude, how many atoms are H2SO4 compound

how many atoms are H2SO4 compound

What factor cause the measurement to change, During gym class Sally noticed...

During gym class Sally noticed that her friend Melissa always ran faster than her. Sally knew that they exercised equally, so she wondered what could cause Melissa to run so fast.

Vitro fertilization - human development, Vitro Fertilization - Human Develo...

Vitro Fertilization - Human Development In case a woman cannot conceive due to her uterine tubes are blocked she can become pregnant by means of in vitro fertilization. In thi

Regulation of the renal function, Q. Which are the three hormones that part...

Q. Which are the three hormones that participate in the regulation of the renal function? Antidiuretic hormone or ADH or vasopressin, atrial natriuretic factor (or ANF) and ald

What is fixative, Question 1 What is fixative? Discuss the characteristics...

Question 1 What is fixative? Discuss the characteristics of a good fixative. What is the importance of using a good fixative for tissue processing? Question 2 What is embe

Explain the term of monosaccharides, Explain the term of Monosaccharides? ...

Explain the term of Monosaccharides? Monosaccharides :  The simplest carbohydrates are Monosaccharides, simple sugars. These generally have three to six carbon atoms, and con

Define agar syringe or agar sausage method, Define Agar Syringe/Agar Sausag...

Define Agar Syringe/Agar Sausage Method? Agar syringe method involves 100 ml syringe, which is filled with agar. A layer of agar is pushed beyond the end of the barrel by means

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd