VASCULAR PLANTS., Biology

Assignment Help:
WHAT TRAITS ALLOWED VASCULAR PLANTS TO GROW TALL

Related Discussions:- VASCULAR PLANTS.

Chordata.., write the classification of chordata?

write the classification of chordata?

Process of asexual reproduction, What name is given to the population of ge...

What name is given to the population of genetically identical offspring which result from a process of asexual (vegetative) reproduction?   The population of genetically id

Identical karyotypes and identical genomes, Q. Can two normal individuals o...

Q. Can two normal individuals of the same species with sexual reproduction have identical karyotypes and identical genomes? And how is the human karyotype usually represented?

Can high blood pressure cause coronary sclerosis, Q. Can High blood pressur...

Q. Can High blood pressure cause coronary sclerosis? High blood pressure causes coronary sclerosis (hardening in early stages, fatty lesions in the inner surface of [he artery

Energy requirements to get ideal body weight, Q. Energy requirements to get...

Q. Energy requirements to get ideal body weight? Calories: The energy requirements of adult patients is governed by their present body weight and the need to maintain a desira

Control of pollution, Control of Pollution We have seen that pollution...

Control of Pollution We have seen that pollution affects human health, 'vegetation, crop yield, trees, fisheries, forests, buildings, archaeological monuments, tourism. These

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How does fecundation occur in angiosperms, After the pollination how does f...

After the pollination how does fecundation occur in angiosperms? In these plants is fecundation dependent on water? After the pollination one of the sperm nuclei from the polle

Explain how a water molecule is produced, Explain how a water molecule is p...

Explain how a water molecule is produced when glucose and fructose undergo a condensation reaction. The glucose molecule releases a hydroxide ion, OH -, and the fructose molec

Define fish as a rich source of protein, Define Fish as a rich source of pr...

Define Fish as a rich source of protein? The edible portion is skeletal muscles of the body. Even though the skeletal muscles of different animals are basically similar, fish s

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd