Values of dpd for plant cells under hypertonic media, Biology

Assignment Help:

Q. What are the values of DPD for plant cells under hypertonic, hypotonic and isotonic media?

In plant cells under hypertonic medium there is loss of water for the external, SF > 0 the vacuolar pressure is high as it is concentrated and TP = 0 there is no distension of the cell wall since the cellular volume is reduced as a result DPD = SF. These cells are known as plasmolysed cells, situation characterized by the retraction of the cell membrane that detach from the cell wall.

In plant cells under isotonic medium there is no raise of the internal water volume, SF > 0 and TP = 0 since the cell wall is not distended. The cell membrane slightly touches the cell wall and in this situation the cell is known as a flaccid cell. In plant cells under hypotonic medium there is tendency of water to enter, SF = TP since the osmotic pressure is totally compensated by the distension of the DPD = 0and cell wall. The cell that has expanded itself to this point is known as a turgid cell.


Related Discussions:- Values of dpd for plant cells under hypertonic media

List the types of gellan gum, List the types of Gellan gum.   The three...

List the types of Gellan gum.   The three types of gellan gums are: High acetyl gellan (partially deacetylated) Low acetyl gellan (highly deacetylated) High cl

Define the term archenteron, Define the term Archenteron ? The name give...

Define the term Archenteron ? The name given to the primitive gut, the first tube that runs through the developing embryo and is open to the external environment. Formed during

What are holandric genes, What are holandric genes? Holandric genes are...

What are holandric genes? Holandric genes are genes situated in the nonhomologous region of the Y chromosome. Holandric genes condition phenotypes that emerge only in men as in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Viruses, are viruses cellular organisms

are viruses cellular organisms

Determine the sarcomere of a skeletal muscle, In the sarcomere of a skeleta...

In the sarcomere of a skeletal muscle, there are A. myosin molecules in the I band. B. both tropomyosin and myosin molecules in the region of the A band that is not in the H

Skin and cornea grafting, SKI N GRAFTING - Skin for grafting is taken ...

SKI N GRAFTING - Skin for grafting is taken from another part of body of the same persons. Now it is possible to grow a sheet of skin in culture from a small piece of skin

Scintigraphy or nuclear medicine, S c inti g r ap h y ...

S c inti g r ap h y or nuclear medicine: Scintigraphy was introduced in veterinary medicine in 1970s. It is highly sensitive and can detect bone dama

Theory of natural selection or darwinism, THEORY OF NATURAL SELECTION OR DA...

THEORY OF NATURAL SELECTION OR DARWINISM Theory of CharIes Darwin (1809 - 1882) about evolution marks the beginning of an era in understanding of evolution. At the age

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd