Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What are the values of DPD for plant cells under hypertonic, hypotonic and isotonic media?
In plant cells under hypertonic medium there is loss of water for the external, SF > 0 the vacuolar pressure is high as it is concentrated and TP = 0 there is no distension of the cell wall since the cellular volume is reduced as a result DPD = SF. These cells are known as plasmolysed cells, situation characterized by the retraction of the cell membrane that detach from the cell wall.
In plant cells under isotonic medium there is no raise of the internal water volume, SF > 0 and TP = 0 since the cell wall is not distended. The cell membrane slightly touches the cell wall and in this situation the cell is known as a flaccid cell. In plant cells under hypotonic medium there is tendency of water to enter, SF = TP since the osmotic pressure is totally compensated by the distension of the DPD = 0and cell wall. The cell that has expanded itself to this point is known as a turgid cell.
List the types of Gellan gum. The three types of gellan gums are: High acetyl gellan (partially deacetylated) Low acetyl gellan (highly deacetylated) High cl
Define the term Archenteron ? The name given to the primitive gut, the first tube that runs through the developing embryo and is open to the external environment. Formed during
What are holandric genes? Holandric genes are genes situated in the nonhomologous region of the Y chromosome. Holandric genes condition phenotypes that emerge only in men as in
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
i want to make a project for class 10
are viruses cellular organisms
In the sarcomere of a skeletal muscle, there are A. myosin molecules in the I band. B. both tropomyosin and myosin molecules in the region of the A band that is not in the H
SKI N GRAFTING - Skin for grafting is taken from another part of body of the same persons. Now it is possible to grow a sheet of skin in culture from a small piece of skin
S c inti g r ap h y or nuclear medicine: Scintigraphy was introduced in veterinary medicine in 1970s. It is highly sensitive and can detect bone dama
THEORY OF NATURAL SELECTION OR DARWINISM Theory of CharIes Darwin (1809 - 1882) about evolution marks the beginning of an era in understanding of evolution. At the age
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd