Using autonomous transactions, Biology

Assignment Help:

Using Autonomous Transactions 

The transaction is a sequence of SQL statements that does a logical unit of work. Frequently, one transaction starts the other. In several applications, a transaction should operate outside the scope of the transaction that executed it. This can happen, for e.g. If a transaction calls out to a data cartridge.

An autonomous transaction is an independent transaction started by the other transaction, the main transaction. The Autonomous transactions suspend the main transaction, to do the SQL operations, commit or roll back these operations, and then resume the major transaction.

1415_autonomous transaction flow.png

Figure: Transaction Control Flow


Related Discussions:- Using autonomous transactions

What is arteriole diameter, The axons of all the baroreceptors in the body ...

The axons of all the baroreceptors in the body were destroyed at 2 AM.  All else is normal.  Which of the following statements is true for the system at 2:10 AM when compared to th

Explain national nutritional anaemia prophylaxis programme, Explain Nationa...

Explain National Nutritional Anaemia Prophylaxis Programme? National Nutritional Anaemia Prophylaxis Programme addresses iron and folate deficiency anaemia (IDA). Preschoolers

Codominance, explain the genotypes for each blood type and how this is an e...

explain the genotypes for each blood type and how this is an example of codominance. Blood type- A, AB, B, 0

How sugar play a major role in preservation, How sugar play a major role in...

How sugar play a major role in preservation? In so many products, sugars play a major role in preservation. The addition of monosaccharides, like glucose or fructose, to jams a

Relaxin - reproduction, Normal 0 false false false EN-I...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Explain denaturation and coagulation, Explain Denaturation and coagulation ...

Explain Denaturation and coagulation Denaturation and coagulation of the proteins are considered to be the chemical changes, since they involve the unfolding of proteins, whic

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define about the pseudosquint, Define about the Pseudosquint (Pseudo-false...

Define about the Pseudosquint (Pseudo-false) Pseudosquint is the condition when despite the visual axis being parallel, there , appears to be a squint. Pseudosquint can be conv

What is metachronal wave. describe., What is Metachronal wave? Describe. ...

What is Metachronal wave? Describe. During the coordination of the ciliary movement, bands, or groups of cilia, are at different stages of their beating pattern, and this creat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd