Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Using Autonomous Transactions
The transaction is a sequence of SQL statements that does a logical unit of work. Frequently, one transaction starts the other. In several applications, a transaction should operate outside the scope of the transaction that executed it. This can happen, for e.g. If a transaction calls out to a data cartridge.
An autonomous transaction is an independent transaction started by the other transaction, the main transaction. The Autonomous transactions suspend the main transaction, to do the SQL operations, commit or roll back these operations, and then resume the major transaction.
Figure: Transaction Control Flow
The axons of all the baroreceptors in the body were destroyed at 2 AM. All else is normal. Which of the following statements is true for the system at 2:10 AM when compared to th
Explain National Nutritional Anaemia Prophylaxis Programme? National Nutritional Anaemia Prophylaxis Programme addresses iron and folate deficiency anaemia (IDA). Preschoolers
Nutrition chat
explain the genotypes for each blood type and how this is an example of codominance. Blood type- A, AB, B, 0
How sugar play a major role in preservation? In so many products, sugars play a major role in preservation. The addition of monosaccharides, like glucose or fructose, to jams a
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Explain Denaturation and coagulation Denaturation and coagulation of the proteins are considered to be the chemical changes, since they involve the unfolding of proteins, whic
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define about the Pseudosquint (Pseudo-false) Pseudosquint is the condition when despite the visual axis being parallel, there , appears to be a squint. Pseudosquint can be conv
What is Metachronal wave? Describe. During the coordination of the ciliary movement, bands, or groups of cilia, are at different stages of their beating pattern, and this creat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd