Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Testing for urine sugars is not recommended for either diagnosis or monitoring of patients with diabetes. This is because a urine sugar is not a reliable test. When no facilities are available for blood sugar testing then one can go in for urine testing using strips or using colour coding chart or testing urine in test tube.
TYPES OF PARTHENOGENESIS - 1 . NATURAL PARTHENOGENESIS - In many animals natural parthenogenesis is common process & is a method of reproduction. It is of two typ
Q. How does the male gamete penetrate the egg cell? How does the female gamete protect itself from the entrance of more gametes after the entrance of the first sperm cell? The
Rejection Reaction For rejection reaction the physiological and biochemical processes are set in the pistil by the recognition reaction specific to the type of pollen that lan
Updating by Deletion DELETE FROM ENROLMENT WHERE StudentId = SID ('S4'); As you can see, this differs from Example by the addition of the noise word FROM. The expression SI
what is the Symptoms of VIBRIO PARAHAEMOLYTICUS Symptoms: A total of greater than one million organisms may cause disease. Symptoms of intoxication which range from mild to se
Explain Diagnosis of Root Perforation 1- Exploration: Continuous bleeding if the defect touched during cleaning and shaping lead to difficult vision. Difficult to d
Q. What is the endosymbiotic hypothesis about the origin of mitochondria? And what are the molecular facts that support the hypothesis? And To which other cellular organelles can t
Q. How can amine groups be classified? Amines can be classified into primary amines, those to which one -R (variable radical) is attached to a -NH 2 , secondary amines, those w
Explain in detail about working of heart Heart has four chambers. Two upper chambers are called atria. Two muscular lower chambers are called ventricles. The right and left
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd