Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Urine Collection:
Untimed or random urine specimens are suitable only for few chemical tests (mainly qualitative test). Usually urine sample is collected over a predetermined period of time, such as 1, 4, or 24 hr.
A clean, early morning, fasting specimen is usually the most concentrated specimen and thus preferred for microscopic examination and for detection of abnormal amounts of constituents such as proteins, or of unusual compounds such as chorionic gonadotropin.
Urine may be collected by voiding, from an inserted catheter, or from suprapubic tap specimen.
Timed urine specimens: the collection period should be long enough to minimize the influence of shot term biological variation. The patient should adhere to the instructions, the bladder should be emptied at the time the collection is to begin, and this urine is discarded. Thereafter, all urine should be collected until the end of the scheduled time. collection should be done in an adequate clean container (3 or 4 liter bottle is usually enough for 24 hr collections). Collection from infants is done using special adhesive plastic bags.
what is a lymphatic vessel
Bubble Oxygenators: These have a mixing chamber where venous blood is collected and from the bottom end micro bubbles of oxygen are passed and as they rise to the top, gas ex
Human lungs A pair of spongy, elastic and bag like structures of lungs is present in the chest cavity, one on either side of the heart. Lungs are enclosed by a double lay
Factors Controlling Stomatal Aperture 'Khul Ja Sim Sim' the two rocks slide and the gates to a great treasure open. With these magic words "Ali Baba and Chalis Chor" could ope
S n ake bite Biting by a poisonous snake is manifested by clinical findings of local swelling and nervous symptoms. E t iology: The poisonous snakes have different typ
How we write assimgment about mycobiology of mycoplasma in detail
Anther is the top of a stamen's filament; divided into pollen sacs in which the pollen grains are form.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the functionality of Central Nervous System ? The central nervous system is the center of the nervous system, receiving impulses from, and sending impulses to, the per
Explain about the Dehydration or Drying? The technique of drying is the oldest method of food preservation practiced by mankind. The removal of moisture, which is actually dehy
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd