Urine collection, Biology

Assignment Help:

Urine Collection:

Untimed or random urine specimens are suitable only for few chemical tests (mainly qualitative test). Usually urine sample is collected over a predetermined period of time, such as 1, 4, or 24 hr.

A clean, early morning, fasting specimen is usually the most concentrated specimen and thus preferred for microscopic examination and for detection of abnormal amounts of constituents such as proteins, or of unusual compounds such as chorionic gonadotropin.

Urine may be collected by voiding, from an inserted catheter, or from suprapubic tap specimen.

Timed urine specimens: the collection period should be long enough to minimize the influence of shot term biological variation. The patient should adhere to the instructions, the bladder should be emptied at the time the collection is to begin, and this urine is discarded. Thereafter, all urine should be collected until the end of the scheduled time. collection should be done in an adequate clean container (3 or 4 liter bottle is usually enough for 24 hr collections). Collection from infants is done using special adhesive plastic bags.

 

 


Related Discussions:- Urine collection

Bubble oxygenators type of oxygenators , Bubble Oxygenators: These ha...

Bubble Oxygenators: These have a mixing chamber where venous blood is collected and from the bottom end micro bubbles of oxygen are passed and as they rise to the top, gas ex

Human lungs, Human lungs A pair of spongy, elastic and bag like stru...

Human lungs A pair of spongy, elastic and bag like structures of lungs is present in the chest cavity, one on either side of the heart. Lungs are enclosed by a double lay

Factors controlling stomatal aperture, Factors Controlling Stomatal Apertur...

Factors Controlling Stomatal Aperture 'Khul Ja Sim Sim' the two rocks slide and the gates to a great treasure open. With these magic words "Ali Baba and Chalis Chor" could ope

Snake bite, S n ake bite Biting by a poisonous snake is manifested by...

S n ake bite Biting by a poisonous snake is manifested by clinical findings of local swelling and nervous symptoms. E t iology: The poisonous snakes have different typ

Mycroboilogy mycoplasma, How we write assimgment about mycobiology of mycop...

How we write assimgment about mycobiology of mycoplasma in detail

Anther, Anther  is the top of a stamen's filament; divided into pollen sacs...

Anther  is the top of a stamen's filament; divided into pollen sacs in which the pollen grains are form.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the functionality of central nervous system, Explain the functional...

Explain the functionality of Central Nervous System ? The central nervous system is the center of the nervous system, receiving impulses from, and sending impulses to, the per

Explain about the dehydration or drying, Explain about the Dehydration or D...

Explain about the Dehydration or Drying? The technique of drying is the oldest method of food preservation practiced by mankind. The removal of moisture, which is actually dehy

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd