Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Ureotelism - Excretion
Terrestrial animals with restricted water availability in the environment are faced with the formidable task of water conservation. Since they cannot afford to use liberal quantities of water for excretion, ammonia is converted into a less toxic product.
In mammals and semi-terrestrial adult amphibians, the major nitrogenous excretory product is urea, which is less toxic and easily soluble. These animals are therefore called ureotelic.
Secretion of Hormones The secretion of most hormones (except steroid) is by the process of exocytosis. Figure summarises the formation, transport, release and reconstitution o
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
classification herpestes
Can you guys help with my homework assignment for Geology?
the appendages of arthropods; a. may serve as walking legs, b. may be modified into atennae, c. may be modified into large pincers, or d. all of the above
Q. Explain about Food Exchange System? In a diabetic's day to day diet, the calorie intake and the quantity of food consumed should not have wide fluctuations. Also the diet sh
Tetanus This is an infectious, non-febrile disease of animals and man, and is characterised by spasmodic tetany and hyperaesthesia. The causative agent is Clostridium tetani,
Define Corneal Ulcer - Micronutrient Deficiencies? Corneal xerosis, if not treated promptly, leads to ulceration of the cornea. Initially, the ulcer may be shallow, and if it b
Q. Why is the dietary obtainment of iodine so important for thyroid functioning? The obtainment of iodine from the diet is vital for the thyroid because this chemical element i
Q. What is the coelom? To which structures do coeloms give birth? Are all animals coelomate? Coeloms are cavities delimited by mesoderm and Coeloms originate the cavities where
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd