unicellular organisms, Biology

Assignment Help:
How was it proved in the case of Amoeba that the key to the life of a cell is Nucleus?

Related Discussions:- unicellular organisms

What the henderson-hasselbalch equation expresses, The Henderson-Hasselbalc...

The Henderson-Hasselbalch equation expresses the pH of a solution as: Select one: a. The equilibrium constant of the acid and the dissociated form of the weak acid. b. The

Determine inharmonious intraspecific ecological interaction, Why is canniba...

Why is cannibalism an inharmonious intraspecific ecological interaction? In cannibalism an individual eats other of the same species (occurs in some insects and arachnids). Sin

Phylum platyhelminyhes, general classification of phylum platy helminthes

general classification of phylum platy helminthes

Cellular features of the beings of the plant kingdom, Q. What are the major...

Q. What are the major cellular features of the beings of the plant kingdom? The typical plant cells are eukaryotic (have nucleus), photosynthetic (use light to make food) and a

What effect does alcohol have on reaction time, (a) What effect does alcoho...

(a) What effect does alcohol have on reaction time? (b) What other short-term effects does alcohol have?  (c) What long-term effects can result from an exce

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Human factor theory - accident causation, Human Factor Theory - Accident Ca...

Human Factor Theory - Accident Causation This theory of accident causation suggests that a chain of events caused by human error is the cause of accident. The chain of events

What is increase in the second messenger, When glucagon binds its receptor ...

When glucagon binds its receptor there is an increase in the second messenger, cAMP. cAMP levels can be decrease by which of the following enzymes? -adenylate cyclase -PDK1

How are the beings of the phylum annelida classified, Q. Concerning the occ...

Q. Concerning the occurrence of separated sexes how are the beings of the phylum Annelida classified? These beings may be dioecious (the majority of polychaetes) or hermaphrodi

Explain dietary diversification - iron deficiency anaemia, Explain the Diet...

Explain the Dietary diversification - Iron Deficiency Anaemia? It aims to ensure that deficient populations have access to foods rich in iron and also foods rich in vitamin C (

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd