Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Undescended Testes (Cryptorchidism)
Undescended testes is a ccmmon disorder. It may be unilateral and may be classified as ectopic cryptorchidism, when the testes are normal in size with a good length of spermatic cord, but have diverged from the normal path and are unable to enter into the scrotum; or true cryptorchidism, when the testes are arrested in the line of normal descent. In true cryptorchidism the testes are often small, ill-formed and relatively immobile with a short spermatic cord. A small percentage of term male newborns and many of the pre-term males have undescended testes at birth. In many cases the testes will descend by the second month with full descent by puberty. If cryptorchidism persist into adult life, failure of spermatogenesis occurs but testicular androgen production usually remains intact. Other complications possibly include trauma, torsion and tumours.
Q. Which animals make cutaneous respiration? Adult amphibians and Terrestrial annelids make cutaneous respiration in amphibians there is also pulmonary respiration, the thin sk
what is entero coelom
Q. What do you mean by Pericardium? Pericardium is the sac covering the heart. Pericardium consists of two layers-the visceral pericardium (epicardium) and the parietal pericar
Describe the factors that are involved in the regulation of respiration in a child who decides to hold his/her breath for as long as possible.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How plants control the opening and the closing of the stomata? The closing and the opening of the stomata depend upon the necessity of the plant to lose water and heat through
The secondary protein structure is produced by the manner its amino acids interact by intermolecular bond. These interactions make a spatial conformation of the polypeptide filamen
MICROORGANISMS : Great care must be taken in microbiological experiments, particularly with pathogenic (disease producing) organisms. Many microorganisms which are normally harmle
Which of the following represents two things that are identical? a.Two alleles for the same gene in a homologous chromosome pair. b.The sequences of DNA in the two sister chr
The A and B antigens in humans may be found in water-soluble form in secretions, including saliva, of some individuals (Se/Se and Se/se) but not in others (se/se). The population t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd