Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Tuberculosis
Tuberculosis is caused by a Bacillus-mycobacterium tuberculosis, a gram- positive and acid-fast organism. It is communicable disease.
Mode of Transmission
By inhalation of tubercle-laden droplet nuclei. When a person with tuberculosis speaks, coughs, sneezes, minute tubercle laden droplet get sprayed into the atmosphere and that remain suspended in the air. Person who breathe the air, inhale these droplets into their respiratory passages.
Describe the concept of soil testing Different grades of complex and mixed fertilizers are being marketed to suit the soil and crops of a region. The recommendations are made o
Define Significance and Impact of Plants and Animals on Human Life? Plants and animals both have a great significance and unparalleled impact on human life. Most of our needs a
what is microbiology
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Photochemical smog results from automobile pollutants reacting with what?
Cryptophytes - Classes of Life Form Perennating buds or shoot apices are buried in the ground at a distance from the soil surface that varies in different species. The buds ar
Q. Explain about Rheumatic Heart Disease? Rheumatic Heart Disease (RHD) is a very common cause of cardiovascular disorder in children and adolescents in India. This disease inv
What is the optimum percentage of forest area recommended by the national forest policy (1988) for the plains and the hills respectively? List any four problems caused because of d
Database Search: Once an open reading frame or the partial amino acid sequence has been pre-determined, the investigator compares sequence with others in the databases using a com
Q. How is fecundation done in insects (internal or external)? Is there copulation between insects? Fecundation in insects is internal, with copulation.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd