Tropical rain forests - ecosystem, Biology

Assignment Help:

Tropical rain forests - Ecosystem

Tropical rain forests occur near the equator. Tropical rain forests are among the most diverse communities on the earth. Both temperature and humidity remain high and more or less uniform. The annual rainfall exceeds 200-225 cm and is generally distributed throughout the year.

The flora is highly diversified: a sq km may contain 300 different species of trees - a diversity unparalled in any other biome. The extremely dense vegetation of the tropical rain forests remains vertically stratified with tall trees often covered with vines, creepers, lianas, epiphytic orchids and bromeliads. Under the tall trees there is a continuous evergreen carpet, the canopy layer, some 25 to 35 metres tall. The lowest layer is an understory of trees, shrubs, herbs, like ferns and palms, all of which become dense where there is a break in the canopy. Soils of tropical rainforests are red latosols, and they may be very thick.

The high rate of leaching makes these soils virtually useless for agricultural purposes, but if they are left undisturbed, the extremely rapid cycling of nutrients within the litter layer which is formed due to decomposition can compensate for the natural poverty of the soil. The common vertebrates of tropical rain forests are the arboreal amphibian Rhacophorus malabaricus, aquatic reptiles, -chameleons, agamids, geckos and many species of snakes and birds, social birds being dominant, and a variety of mammals. Nocturnal and arboreal habits are most common in many mammals such as insectivores, leopard, jungle cats, anteaters, giant flying squirrels, monkeys and sloths.


Related Discussions:- Tropical rain forests - ecosystem

Lipids, How are lipids classified?

How are lipids classified?

What are the three major types of rna, Q. What are the three major types of...

Q. What are the three major types of RNA? What is meant by heterogeneous RNA? Messenger RNA, or mRNA, transfer RNA, or tRNA, and ribosomal RNA, or rRNA, are the three main type

How many different genotypes can the individual present, Considering a pair...

Considering a pair of homologous chromosomes containing a gene having two different alleles how many different genotypes can the individual present? If a gene of the diploid sp

History of quantitative impacts on biology, Show History of Quantitative Im...

Show History of Quantitative Impacts on Biology Quantitative threads have been woven into the fabric of biology since at least the late 19th century, when Malthus warned of the

Explain about cloning, What is Cloning Cloning: Somatic (ie 2N) cell fr...

What is Cloning Cloning: Somatic (ie 2N) cell from original female cat removed (nucleus has mutated allele), fertilised egg extracted from another cat, nucleus removed, and egg

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the significance of torsion, What is the significance of torsion? ...

What is the significance of torsion? An unusual twisting of the gastropod body which has left all members of class with an asymmetric body plan and a U-shaped alimentary tract,

Excretory organs, Normal 0 false false false EN-IN X-...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Viscosity - blood flow, Normal 0 false false false EN-I...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Define the clinical success for the root canal treatment, Define the Clinic...

Define the Clinical success for the Root Canal Treatment a) Absence of pain and swelling. b) Disappearance of sinus tract. c) No evidence of soft tissue destruction, incl

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd