Transplantation, Biology

Assignment Help:

Transplantation -

  • It is implanting of a living or preserved tissue or organ from one site to another side in the same individual or from one individual called donor to recipient.
  • Cornea transplant performed in 1905 was one of first organ transplant.
  • First kidney transplant was done between identical twins in 1954 by Dr. Charls Hufnagel.
  • Christian Bernard performed the first heart transplant.
  • The problem in tissue transplanation is of shortage of compatible donors & the rejection ractions graft reaction is of 3 types - acute, hyperacute & chronic.
  • According to the site of transplantation, there are 2 types -

1. Orthopic graft - If it is transplanted at normal recipient site eg. heart transplant.

2. Heterotopic graft - If it is transplanted at abnormal site e.g. kidney transplant in iliac fossa.

According to the genetic relationship between donor & recipient it is of 4 types -

1.       Syngeneic or Autograft -

Same individual

2.       Isogeneic or isograft -

Same species gentically identical.

3.       Allogenecic or allograph -

Same species genetically unrelated.

4.       Xenogenic graft or xenograph -

Different species.


Related Discussions:- Transplantation

Growth and development, details and terms used in growth and development?

details and terms used in growth and development?

Objective of the radiographic technique, Objective of the Radiographic Tech...

Objective of the Radiographic Technique The ball bearings are opaque and their diameter have to be measured with the help of vernier caliper prior to use. (2 to 5 mm diameter b

Explain clostriduim botulinum, Q. Explain Clostriduim botulinum? Clostr...

Q. Explain Clostriduim botulinum? Clostriduim botulinum is widely distributed in soil and marine sediments throughout the. world. It is also found in the intestinal tract of a

What are the predominating chemical compounds, What are the predominating c...

What are the predominating chemical compounds respectively in eggshell, white and yolk? The eggshell is essentially made of calcium carbonate. The white, or albumen, is compose

Gastric mucosa protected from the acid ph of the stomach, Q. How is the gas...

Q. How is the gastric mucosa protected from the acid pH of the stomach? The gastric epithelium is mucus secretory that is it produces mucus, the mucus covers the stomach wall p

Technique-recurrence of angina, Technique:  Careful re-opening of ste...

Technique:  Careful re-opening of sternum and release of steinum from the underlying adhesion is done. Femoral artery and vein are exposed for going on femoro fenioral bypass

Male reproductive disorders-congenital impotentia genarandi, Congenital imp...

Congenital impotentia genarandi Some bulls which are otherwise normal and healthy produce semen containing spermatozoa with specific morphological abnormalities together with

Monocot and dicot plants, project formate for monocot and dicot plants in f...

project formate for monocot and dicot plants in feild per month

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd