transpiration, Biology

Assignment Help:
Most of the water taken up by a plant passes through it and is evaporated to the atmosphere.What use is made of the tiny fraction of this water which is retained by the plant?

Related Discussions:- transpiration

Isolating mechanism, In this section we are to discuss the means by which p...

In this section we are to discuss the means by which populations get separated or isolated from each other, first gain the status of'Sub-species and finally evolve mechanisms which

Do all genetic diseases result no. chromosomes of the cells, Do all genetic...

Do all genetic diseases result from alteration in the number of chromosomes of the cells? Besides aneuploidies there are other genetic diseases, other chromosomal abnormalities

The lower course - classification of the river, The lower course - Classifi...

The lower course - Classification of the river The lower course of the river occurs in the plains, across which it meanders or zigzags slowly. The river here loses much of its

Codominance, explain the genotypes for each blood type and how this is an e...

explain the genotypes for each blood type and how this is an example of codominance. Blood type- A, AB, B, 0

Explain the principles of isolated soybean proteins, Principles of Isolated...

Principles of Isolated soybean proteins The basic principles of ISP production are simple. Soybean protein isolates are obtained by selective solubilisation of  the protein (e.

What is isozymes, ISOZYMES : an enzyme having different molecular forms bu...

ISOZYMES : an enzyme having different molecular forms but catalyzing the same reaction.

Synthetic Biology, I need analysis of Stza gene in Aspergillus nidulans thr...

I need analysis of Stza gene in Aspergillus nidulans through synthetic biology, OpenWetWare and Biobricks

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Maintenance of the normal quantity of chromosomes, Q. Why is meiosis signif...

Q. Why is meiosis significant for the maintenance of the normal quantity of chromosomes of a species with sexual reproduction? A reduction to a half of the maximum normal quant

Seed dispersal, what are the characteristics of the stages in seed dispersa...

what are the characteristics of the stages in seed dispersal

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd