transcription, Biology

Assignment Help:
function of topoisomerace?

Related Discussions:- transcription

Explain in brief about the extra-ocular muscles, Extra-ocular muscles ...

Extra-ocular muscles There are, as you know, six extra-ocular muscles. Out of these, four are recti(straight) and two are oblique. They control the position and movement of th

Techniques of plant tissue culture, Techniques of Plant Tissue Culture ...

Techniques of Plant Tissue Culture A standard tissue culture laboratory should provide facilities for washing and storage of glass ware, preparation and storage of nutrient

The identity and amounts of elements in the molecule, If the chemical formu...

If the chemical formula of a substance is C17 H 31 COOH, what can you tell about the identity and amounts of elements in the molecule? Can someone please explain me this?

Define non-digestible oligosaccharides (ndo), Define Non-Digestible Oligosa...

Define Non-Digestible Oligosaccharides (NDO) Among the various food components, the best prebiotic effects seen to be exerted by the NDOs. They are oligomeric carbohydrates, wh

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the function of the umbilical cord, Q. What is the function of the ...

Q. What is the function of the umbilical cord? The umbilical cord is a set of blood vessels that connects the fetus with the placenta and in the fetus one extremity of the cord

Does the dna replication occur in the cell division, Q. Does the DNA replic...

Q. Does the DNA replication occur in the cell division? Yes. The DNA replication occurs in mitosis as well in the meiosis.

Explain about the food product development, Explain about the Food product ...

Explain about the Food product development? Food product development is often commodity related. This type of research needs to be carried out in the pilot plants with the equi

Phylum protozoa, What is the classification of this phylum

What is the classification of this phylum

Define health effects related to probiotics, Define Health Effects related ...

Define Health Effects related to Probiotics? Several lines of evidence support the conclusion that normal gut microflora are involved in resistance to disease, especially gastr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd