Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Tooth associated with Persistent apical periodontitis
Functional retention of the tooth : persistent lesion while remain asymptomatic function for an extended period of time .
-Patient's goal is to retain his tooth without pain, it may not need to complete healing , but follow up .
- Uncertain healing : if sign or symptoms of persistent infection ( progressive enlarging periapical radiolucency , periodontal pocket formation , sinus tract )
- Further retreatment is needed.
- To determine that the case has persistant periapical periodontitis, we should determine the function of the tooth and the healing is it proper or not.
- We should do complete evaluation to the case before start treatment " determine if the tooth is restorable or not, can I remove obturating material or not "
Is it possible for a hermaphrodite species to present cross-fecundation? There are hermaphrodite species of animals and plants that present cross-fecundation mainly because of
Q. What are gonads? What are the male and the female gonads in humans? Gonads are the organs that produce gametes they contain the germ cells that undergo division and generate
Q. Fats requirements during congestive cardiac failure? Fat: The quantity and quality of fat would be governed by the severity of hyper- lipidemia and adiposity. Emphasis, as
What do you determine by Atriopore? The external opening to atrium. In cephalochordates water passes across pharyngeal slits into atrium and from there leaves through atriopore
Biochemical Function - Essential Elements Elements Mg, Mn, K, Ca and Fe are cofactors for many enzymatic reactions. Fe is carrier of electrons in electron transfer chain. Phos
Enumerate about the Mycotic Infections Invasion of the nervous system by a fungus is known as a mycotic infection. A fungus is any member of a large group of lower plants (in s
Explain the Stages In Taxonomic Procedures? Divided into three levels or phases: 1) Alpha (α) phase, 2) Beta (β) phase, 3) Gamma (γ) phase. Alpha Taxonomy The
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Briefly explain the difference between stabilizing selection, directional selection, and disruptive selection.
Define Clinical Features and Medical Complications of Anorexia Nervosa? Anorexia nervosa, as we have learnt above, is a disorder characterized by deliberate weight loss, induce
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd